4/2017
Kamalova D.K.1, Kuybagarov M.A.1, Abeev A.B.2, Shvedyuk V.B.1, Balykbaev K.O.2, Kiyanbekova L.S.2, Aushakhmetova Z.T.2, Shevtsov A.B.1
1National Center for Biotechnology,
13/5, Korgalzhyn road, Astana, 010000, Kazakhstan
2National Center of Expertise,
Zheltoksan str., 46,  Astana, 010000, Kazakhstan
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

Enterovirus infections are widespread throughout the world. The clinical manifestation of enterovirus infection can lead to serious and fatal complications. Express PCR diagnosis and genotyping allows controlling the epidemiological situation and predicting the severity of the infection. In Kazakhstan, there are no locally produced PCR test kits. In addition there is no regular monitoring of circulating genotypes of enteroviruses. This study was aimed to develop a PCR protocol for the enterovirus detection based on the amplification of the 5' untranslated region (5' NTR) and genotyping by sequencing of enteroviruses circulating in Kazakhstan in 2016 - 2017. In this study 74 cDNA samples were used. The results obtained with developed protocol were well correlated (97.3%) with the results of the commercial PCR testing kit. The advantage of the developed protocol is genotyping of enteroviruses by sequencing of the amplified DNA fragment. Fifty nine samples were genotyped, of which 54.7% belong to enterovirus B, 35.9% are classified as enterovirus A and 1.56% are classified as enterovirus C. Ninety-three percent of meningitis-associated genotypes were identified as enterovirus B, and clustered with E-9, E-18, CV-B5 and E-30. Samples of DNA that isolated from patients with enterovirus infection were clustered with the CV-A6 genotype.

Key words: enterovirus, PCR, genotyping, 5 'NTR region, serous meningitis, intestinal infection


УДК 578.2:577.29

 

РАЗРАБОТКА ПЦР ПРОТОКОЛА ВЫЯВЛЕНИЯ ЭНТЕРОВИРУСОВ ЧЕЛОВЕКА НА ОСНОВЕ АНАЛИЗА 5'-NTR РЕГИОНА И ЕГО ИСПОЛЬЗОВАНИЕ В МОЛЕКУЛЯРНОЙ ЭПИДЕМИОЛОГИИ

Камалова Д.К.1, Куйбагаров М.А.1, Абеев А.Б.2, Шведюк В.Б.1, Балыкбаев К.О.2, Киянбекова Л.С.2, Аушахметова З.Т.2, Шевцов А.Б.1
1Национальный центр биотехнологии,
Кургальжинское шоссе, 13/5, Астана, 010000, Казахстан
2Национальный центр экспертизы,
ул. Желтоксан, 46,
Aстана, 010000, Казахстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

АБСТРАКТ

Энтеровирусные инфекции широко распространены во всем мире и представляют собой глобальную проблему для здравоохранения. Клиническое проявление энтеровирусной инфекции многолико и может привести к серьезным осложнениям вплоть до летального исхода. Экспресс-диагностика методом ПЦР и генотипирование позволяет контролировать эпидемиологическую ситуацию и прогнозировать тяжесть инфекции. В Казахстане нет отечественных ПЦР тест-систем и не ведется регулярный мониторинг циркулирующих генотипов. Данное исследование было направлено на разработку ПЦР протокола выявления энтеровирусов на основе амплификации фрагмента 5' нетранслируемой области (5' NTR) и ее секвенирование при генотипировании энтеровирусов, циркулирующих в Казахстане в 2016-2017 годах. В исследовании было использовано 74 образца кДНК. Результаты, полученные с использованием разработанного протокола, на 97,3% коррелировали с результатами коммерческой ПЦР тест-системы. Преимущество разработанного протокола заключается в возможности генотипирования энтеровирусов методом секвенирования амплифицируемого фрагмента. Генотипированы 59 образцов, из которых 54,7% относится к энтеровирусу B, к энтеровирусам А отнесены 35,9% и к С – 1,56%. Девяносто три процента генотипов, ассоцированных с менингитом, идентифицированы как энтеровирус В, и кластеризовались с Е-9, Е-18, CV-B5 и Е-30. Образцы кДНК, выделенные от пациентов с энтеровирусной инфекцией, кластеризовались с генотипом CV-A6.

Ключевые слова: энтеровирус, ПЦР, генотипирование, 5' NTR регион, серозный менингит, кишечная инфекция.


ВВЕДЕНИЕ

Энтеровирусы – маленькие, безоболочечные, РНК содержащие вирусы семейства Picornaviridae. Энтеровирусы, на основании молекулярных характеристик гена VP1, классифицируются на 12 видов, 7 из которых патогенны для людей: энтеровирусы А-D и риновирусы A, B и C [1]. Несмотря на свои размеры, энтеровирусы представляют собой глобальную проблему для здравоохранения. Только на программу эрадикации полиомиелита за 24 года затрачено более 9 млрд. долларов США. Неполиомиелитные энтеровирусы также влекут опасные последствия. Только в Китае за 5 лет было зарегистрировано более 7 млн. случаев энтеровирусного везикулярного стоматита, что привело к гибели 2,5 тысяч людей [2].

Для проведения молекулярно-генетического мониторинга за популяционной структурой возбудителей энтеровирусных инфекций с целью оценки, прогнозирования эпидемической ситуации и обоснования своевременного вмешательства в ход эпидемического процесса, необходимо стандартизировать подходы выявления вируса и его типизацию. Ранее диагностика энтеровирусных инфекций при спорадической заболеваемости была чрезвычайно трудна в связи с широким распространением носительства и нередким нарастанием титра антител к ним у здоровых пациентов. Разработка метода ОТ-ПЦР (обратная транскрипция) позволила выявлять непосредственно самого возбудителя в клиническом материале [3] . Лабораторная генодиагностика энтеровирусных инфекций в настоящее время основывается на амплификации высококонсервативных участков в пределах энтеровирусной РНК–геномы [4]. Самым консервативным и по этой причине целевым регионом в диагностических процедурах является 5′ некодирующий регион (5′NCR) РНК энтеровирусов, в котором содержатся вторичные структуры клеверных и внутренних рибосом [5].

Изначально типизация вируса предусматривала непосредственное выделение изолята и его серотипирование в реакции нейтрализации. Классическое серотипирование энтеровирусов – трудоемкая процедура, требующая большого количества типовых сывороток, клеточных линий. Кроме того, метод не позволяет проводить идентификацию всех серотипов [6, 7]. Изучение энтеровирусов позволило установить, что VP1 является главным иммунодоминантным капсидным белком и содержит важные серотип-специфические сайты нейтрализации. При этом сравнение нуклеотидных и аминокислотных последовательностей VP1 энтеровирусов известных серотипов показало полную корреляцию [8]. В дальнейшем данный метод стал с успехом заменять классический метод типизации, основанный на реакции нейтрализации. На основании принципа секвенирования VP1 гена под эгидой ВОЗ разработаны методические рекомендации по генотипированию изолятов энтеровирусов непосредственно в клиническом материале [9]. VP1 гипервариабелен и для определённых генотипов требуется дизайн праймеров. Кроме того, в сложных образцах, включая объекты внешней среды, энтеровирусы удается генотипировать редко [10]. Напротив 5’ NTR регион более консервативен и является регионом выбора для ОТ-ПЦР при диагностике энтеровирусов, но не является идеальной мишенью для генотипирования вируса [11]. Тем не менее, результаты генотипирования, получаемые с использованием двух регионов VP1 и 5’NTR, согласуются между собой, за исключением случаев рекомбинации. Кроме того, эффективность амплификации 5’ NTR региона выше в сравнении с последовательностями, кодирующими белки [12]. Поэтому использование 5’ NTR в сложных клинических образцах может быть критерием выбора при первичной типизации. В Казахстане, несмотря на сложную эпидемиологическую обстановку, мало информации о циркулирующих генотипах энтеровирусов.

Цель данного исследования заключалась в разработке унифицированного метода, который позволяет выявлять РНК энтеровирусов человека и проводить первичную типизацию на основе данных секвенирования амплифицируемой области. Для этого нами предложена ПЦР с электрофоретической детекцией 5' нетранслируемой области (5'NTR), позволяющая обнаруживать группы энтеровирусов (А-D). Последующее секвенирование амплифицируемого фрагмента дает возможность проводить первичное генотипирование энтеровирусов.

 

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Клинические образцы и изоляты вирусов

С января 2016 по август 2017 года было собрано 65 образцов клинического материала в детских инфекционных больницах 5 областей Казахстана и двух городов республиканского значения (Астана, Алматы). В исследование также были включены 9 изолятов вируса, выделенные от пациентов с серозным менингитом и энтеровирусной инфекцией. Выделение вирусной РНК из клинического материала выполняли с использованием набора «QIAampViral RNA MiniKit» (QIAGEN, Германия) согласно инструкции производителя. После выделения РНК синтезировали кДНК с применением комплекта реагентов для получения кДНК на матрице РНК «РЕВЕРТА-L» (ФГУН ЦНИИЭ Роспотребнадзора). Детекцию энтеровирусов осуществляли с использованием набора реагентов для выявления РНК энтеровирусов (Enterovirus) в объектах окружающей среды и клиническом материале методом полимеразной цепной реакции (ПЦР) c гибридизационно-флуоресцентной детекцией «АмплиСенс®Enterovirus-FL» (ФГУН ЦНИИЭ Роспотребнадзора).

В 55 из 65 образцов кДНК, полученных из клинического материала, установлено наличие энтеровирусов с использованием тест-системы «АмплиСенс® Enterovirus-FL». В 10 образцах энтеровирусная инфекция установлена не была. Характеристика образцов с энтеровирусной инфекцией из клинического материала и изолятов вируса приведена в таблице 1.

 

Таблица 1. Характеристика клинического материала и изолятов вируса
Table 1. Characteristics of clinical material and isolates of the viruses

Материал

 

Material

Диагноз

 

Diagnosis

Регионы

 

Regions

 Астана

 Алматы

Павлодарская область

Акмолинская область

Западно -Казахстанская область

Карагандинская область

Кызылординская область

ИТОГО

Спинномозговая жидкость (CSF)

 

Cerebrospinal fluid

(CSF)

Серозный менингит

6

0

0

0

0

0

0

6

Гнойный менингит

1

0

0

0

0

0

0

1

Менингит

1

0

0

0

0

0

0

1

Обследование

1

0

0

0

0

0

0

1

Энтеровирусная инфекция (ЭВИ)

1

0

0

0

0

0

0

1

Фекалии

 

Fecal matter

Серозный менингит

3

0

0

0

0

0

0

3

Гнойный менингит

1

0

0

0

0

0

0

1

Обследование

3

0

0

0

0

0

0

3

Энтеровирусная инфекция

21

2

2

5

5

0

0

35

ОРВИ

1

0

0

0

0

0

0

1

Острая кишечная инфекция

1

0

0

0

0

0

1

2

Изоляты вирусов

 

Isolates of enteroviruses

Серозный менингит

2

0

0

0

0

0

0

2

Энтеровирусная инфекция

4

2

0

0

0

1

0

7

Общее количество

46

4

2

5

5

1

1

64

 

 Подбор праймеров

Для подбора праймеров из международной базы данных NCBI были взяты полногеномные нуклеотидные последовательности энтеровирусов, входящих в группы EV-A до EV-D. Данные последовательности были выровнены с использованием программного обеспечения BioEdit и к консервативным участкам 5' нетранслируемого региона подобраны праймеры. Анализ праймеров на образование вторичных структур (димеров, шпилек) проводили с использованием программного обеспечения PrimerSelect (DNA STAR). Оценка отжига праймеров на другие геномы (бактерии, вирусы, животные, растения и т.д.) проводилась с использованием приложения PrimerBlast в международной базе NCBI. Праймеры, имеющие тугоплавкие вторичные структуры, а также комплементарные не целевым мишеням, были исключены.  

 

Определение нуклеотидной последовательности

Очистку ПЦР продуктов проводили ферментативным методом, используя экзонуклеазу I и щелочную фосфотазу (Thermo Fisher Scientific). Для реакции секвенирования применяли BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) согласно инструкции производителя. Продукты очищали осаждением этанолом с ацетатом натрия, капиллярное разделение проводили на автоматическом генетическом анализаторе 3730xl DNA Analyzer (Applied Biosystems). Последовательность с прямого и обратного праймера объединяли в программном обеспечении SeMan (LaserGene, DNASTAR). Построение филогенетического дерева проводили используя Mega 7, метод максимального правдоподобия, модель Kimura 2-parameter, гамма распределение и Bootstrap анализ (500 повторов). В анализ включали последовательности генотипов, имеющих максимальную идентичность в BLAST базе данных NCBI, с выбором целевых организмов Enteroviruses (taxid:12059).

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Подбор праймеров

Праймеры играют ключевую роль в чувствительности и специфичности ПЦР реакции, поэтому выбору ДНК/кДНК мишени и структуре праймеров уделяется большое внимание. При этом, если цель исследования заключается в генотипировании генетических вариантов, видов или подвидов, как правило, используются фрагменты с высокой вариабельностью. При разработке теста на общую таксономическую единицу вид, род, праймеры подбираются на наиболее консервативный участок. Целью данного исследования являлась разработка ПЦР теста с электрофоретической детекцией, позволяющего выявлять большинство генетических вариантов энтеровирусов, численность которых в настоящий момент превышает 100 серовариантов [13, 14]. К консервативным участкам 5' нетранслируемого региона были подобраны праймеры (таблица 2).

 

Таблица 2. Праймеры для амплификации 5'-NTR последовательности энтеровирусов
Table 2. Primers for amplification of 5'-NTR of the enterovirus sequence

Наименование

 

Name

Последовательность (5’-3’)

 

Sequence (5’-3’)

Ссылка

 

Reference

E4KB-F

aaggtgygaagagyctattgagcta

[15]

E1-R

caccggatggccaatcca

Thoelen

ent-95-F

CGGTACCYTTGTRCGCCTGTTT

Данное исследование

ent-490-F

GGCCCCTGAATGYGGMTAA

Данное исследование

ent-661-F

ACTACTTTGGGTGTCCGTGTTTC

[15]

ent-600-rev

GAAACACGGACACCCAAAGTAGT

[16]

ent-1300-1R

AGAACATCTGGAAACTTCCAVTACCA

Данное исследование

ent-1300-2R

CATCAGGGARYTTCCACCACCA

Данное исследование

 

Оптимизация условий

Для оптимизации условий праймеры разделили в 5 комбинациях: 1 комбинация – праймеры E4KB-F и E1-R; 2 комбинация – ent-95-F и ent-600-rev; 3 комбинация – ent-490-F, ent-1300-1R и ent-1300-2R; 4 комбинация – ent-661-F, ent-1300-1R и ent-1300-2R; 5 комбинация – ent-95-F, ent-1300-1R и ent-1300-2R.

Оптимизацию условий проводили на 4 образцах кДНК, выделенных из биологического материала, в котором с использованием коммерческого набора «АмплиСенс® Enterovirus-FL» (АмплиСенс, Россия) было установлено наличие РНК энтеровирусов. ПЦР с 1 комбинацией праймеров проводили согласно рекомендациям Thoelen с соавторами. Для комбинаций 2-5 были единые параметры реакционной смеси: праймеры по 12 пмол каждого, 1-х буфер к HotStartPol (Jena Bioscience), 2 мМ MgCl2, дНТФ в финальной концентрации 200 нМ каждого, 1,5 единицы Hot Start Taq полимеразы (Jena Bioscience). Программа ПЦР амплификации: длительная денатурация 95°С – 3 минуты; 40 циклов 95°С – 30 секунд, 59°С – 40 секунд, 72°С – 1 минута 30 секунд; финальная элонгация 7 минут при 72°С. Результаты оптимизации приведены на рисунке 1.

 
М – маркер молекулярного веса (100-600 bp); 1-4 – образцы; К1-К2 – отрицательный контроль
Рис. 1. Электрофоретический учет результатов ПЦР оптимизации по 5 парам праймеров
M – marker of molecular weight (100-600 bp); 1-4 –samples; K1-K2 – negative control
Fig. 1. Electrophoretic recording of PCR optimization results for 5 pairs of primers

 

Как видно на рисунке 1, в электрофоретических дорожках 1-й комбинации присутствуют неспецифические продукты ПЦР амплификации. Из других 4 комбинаций наибольшая специфичность и эффективность ПЦР наблюдалась при использовании пары праймеров ent-95-F 5’-cggtaccyttgtrcgcctgttt-3’ и ent-600-rev 5’-gaaacacggacacccaaagtagt-3’. Присутствие дополнительных ПЦР продуктов во 2 комбинации на уровне 100-300 п.н. потребовало проведения дополнительной оптимизации по температуре отжига и концентрации ионов магния.

На следующем этапе оптимизации изменяемыми показателями являлись температура отжига и концентрация ионов магния. Всего было использовано 8 оптимизационных вариантов: 1) MgCl2 1,5 mM, температура отжига 60,1ºС; 2) MgCl2 2 mM, температура отжига 60,1ºС; 3) MgCl2 1,5 mM, температура отжига 62ºС; 4) MgCl2 2 mM, температура отжига 62ºС; 5) MgCl2 1,5 mM, температура отжига 64,6ºС; 6) MgCl2 2 mM, температура отжига 64,6ºС; 7) MgCl2 1,5 mM, температура отжига 66ºС; 8) MgCl2 2 mM, температура отжига 66ºС. Результаты оптимизации приведены на рис. 2.

Из рисунка 2 видно, что оптимальным является вариант №5 с концентрацией ионов магния 1,5 mM и температурой отжига 64,6ºС. При использовании температуры отжига в 66ºС отмечается снижение эффективности амплификации, о чем свидетельствует понижение интенсивности свечения ПЦР продуктов. В остальных составах понижение температуры отжига или увеличение концентрации ионов магния приводит к появлению неспецифических ПЦР продуктов. На основании полученных результатов был оптимизирован состав реакционной смеси и условия ПЦР реакции.

Реакционная смесь: праймеры ent-95-F 5’-cggtaccyttgtrcgcctgttt-3’ и ent-600-rev 5’-gaaacacggacacccaaagtagt-3’ по 12 пмоль каждого; 1-х буфер к HotStartPol (Jena Bioscience); 1,5 мМ MgCl2 дНТФ по 200 нМ каждого; Hot Start Taq полимераза (Jena Bioscience) – 1,5 единицы. Программа ПЦР амплификации: длительная денатурация 95°С – 3 минуты; 40 циклов 95°С – 30 секунд, 64°С – 40 секунд, 72°С – 1 минута 30 секунд; финальная элонгация 7 минут при 72°С.

 
М – маркер молекулярного веса (100-600 п.н. шаг 100 п.н.)
Рис. 2. Электрофоретический учет результатов ПЦР оптимизации по температуре отжига и концентрации ионов магния
M – marker of molecular weight (100-600 bp with 100 bp by step)
Fig. 2. Electrophoretic recording of the results of PCR optimization on annealing temperature and magnesium ion concentration

 

Апробация разработанного протокола

С целью проверки оптимизированных условий проведена апробация на 74 образцах кДНК, 65 из которых выделены из клинического материала и 9 образцов выделены из культуральной жидкости, содержащей энтеровирусы. В результате апробации в двенадцати образцах разработанным протоколом не был амплифицирован ПЦР продукт. В 10 из 12 образцах РНК энтеровируса не была выявлена также коммерческим набором «АмплиСенс® Enterovirus-FL», а в двух образцах пороговый цикл в ПЦР в режиме реального времени превышал 35.

 

Использование нуклеотидной последовательности 5’ NTR региона в генотипировании энтеровирусов

Нуклеотидная последовательность была получена для 62 образцов кДНК. В трех образцах фекалий на фореграммах секвенирования отмечалось наложение сигнала, указывающего на наличие нескольких генотипов в пробе. Для оставшихся 59 образцов были получены нуклеотидные последовательности 5’ UTR региона, пригодные для генотипирования. В результате филогенетического анализа анализируемые образцы кластеризовались в три ветви с последовательностями от Enteroviruses A, B, и С (рис. 3).

Самая многочисленная ветвь включала в себя 35 последовательностей от исследуемых образцов и последовательности Enteroviruse B. В данной группе не отмечается четкая кластеризация между клиническим проявлением инфекции и генотипом энтеровирусов. Тем не менее, вместе с Enteroviruse B кластеризовалось 13 из 14 последовательностей, полученных от пациентов с менингитами, более 60% из которых объединились с эховирусами 9, 18 и 14.

С Enteroviruse A сгруппировались 23 последовательности, из которых 20 получены из образцов пациентов с клиническим диагнозом «ЭВИ». Самая многочисленная клада включала в себя 15 последовательностей с диагнозом ЭВИ, 1 последовательность от пациента с острой кишечной инфекцией и последовательности вируса Коксаки, циркулирующих в Азиатском регионе. Последовательность от пациента с менингитом кластеризовалась с вирусом Коксаки А10. Одна последовательность от пациента с острой кишечной инфекцией из Кызылординской области кластеризовалась с генотипами Enteroviruse С.

fig3

 
Клинический материал от пациентов с: □ острой кишечной инфекцией; ■ с обcледования; ● энтеровирусная инфекция; ▲ острой респираторной вирусной инфекцией; ◊ менингитами (серозный, гнойный)
Рис. 3. Филогенетическое дерево генотипов энтеровирусов, циркулирующих в Казахстане в 2016-2017 годах (5’ UTR регион)
Clinical material from from patients with: □ acute intestinal infection; from examination; ● enterovirus infection; ▲ acute respiratory viral infection; ◊ meningitis (serous, purulent)
Fig. 3. Phylogenetic tree of genotypes of circulating in Kazakhstan in 2016 and 2017 (5 'UTR region)

 

Генотипирование энтеровирусов является мощным инструментом для эпидемиологического мониторинга и позволяет отследить источник вспышки и пути распространения, а также эволюцию вируса [17]. Быстрое генотипирование необходимо для определения генотипов вирусов, которые могут провоцировать крупные вспышки менингита и/или связанные с необычными клиническими проявлениями инфекции. В нашем исследовании 59 генотипированных образцов отнесены к трем видам энтеровирусов – A, B и С. Самая многочисленная группа – энтеровирусы В, включила в себя CV-B5, CV-B3, CV-A9, CV-A2, CV-B1, E-9, E-3, E-18. Наибольшая ассоциация с менингитами наблюдалась с генотипами Е-9, Е-18, CV-B5 и Е-30. Ранее данные генотипы были зарегистрированы в качества источника асептических менингитов в единичных и эпизодических вспышках в Кувейте, Греции, Австралии, Корее, Южной Африке и России [18]. Наибольшее число случаев энтеровирусной инфекции 2016-2017 гг. ассоциировано с генотипом CV-A6. Данный генотип был основным возбудителем везикулярного энтеровирусного стоматита в последние годы в Китае [19], ранее он также вызывал вспышки этой инфекции в Японии, Сингапуре, Финляндии, Тайване и США [20].

В 2017 году произошло резкое увеличение случаев энтеровирусной инфекции, вызванных CV-B5. В 2009 году в Китае с данным генотипом была ассоциирована крупная вспышка менингита [21], что указывает на необходимость мониторинга данного генотипа в Казахстане.

 

ВЫВОДЫ

На основании полученных результатов можно сделать вывод о высокой специфичности разработанного ПЦР протокола. Протокол по чувствительности уступает методу ПЦР с детекцией в режиме реального времени, однако позволяет проводить первичную идентификацию энтеровирусов на основании анализа нуклеотидной последовательности 5’ UTR региона.

 

Финансирование

Работа выполнялась в рамках научно-исследовательской работы «Разработка тест-системы генотипирования энтеровирусов и мониторинг генотипов, циркулирующих на территории Казахстана».

 

REFERENCES

 

 

  1. Xiang Z., Tsatsral S., Liu C. et al. Respiratory infection with enterovirus genotype C117, China and Mongolia. Emerg. Infect. Dis., 2014, vol. 20, pp. 1075-1077.
  2. Xing W., Liao Q., Viboud C. et al. Hand, foot, and mouth disease in China, 2008-12: an epidemiological study. Lancet. Infect., Dis., 2014, vol. 14, pp. 308-318.
  3. Gorgievski-Hrisoho M., Schumacher J.D., Vilimonovic N. et al. Detection by PCR of enteroviruses in cerebrospinal fluid during a summer outbreak of aseptic meningitis in Switzerland. J.Clin.Microbiol., 1998, vol. 36, pp. 2408-2412.
  4. Romero J.R. Reverse-transcription polymerase chain reaction detection of the enteroviruses. Arch. Pathol. Lab. Med., 1999, vol. 123, pp. 1161-1169.
  5. Thoelen I., Lemey P., I. Van der Donck et al. Molecular typing and epidemiology of enteroviruses identified from an outbreak of aseptic meningitis in Belgium during the summer. J. Med. Virol., 2000, vol. 70, pp. 420-429.
  6. Tsao K.C., Huang C.G., Huang Y.L. et al. Epidemiologic features and virus isolation of enteroviruses in Northern Taiwan during 2000-2008. J. Virol. Methods., 2010, vol. 165, pp. 330-332.
  7. Singh S., Chow V.T., Phoon M.C. et al. Direct detection ofenterovirus 71 (EV71) in clinical specimens from a hand, foot, and mouth diseaseoutbreak in Singapore by reverse transcription-PCR with universal enterovirusand EV71-specific primers. J. Clin. Microbiol., 2002, vol. 40, pp. 2823-2827.
  8. Oberste M.S., Maher K., Kilpatrick D.R., Pallansch M.A. Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classification. J. Jurnal. Virology, 1999, vol. 73, pp. 1941-1948.
  9. WHO/CDC Enterovirus surveillance guidelines. Denmark, World Health Organization, 2015, vol. 46.
  10. Ibrahim W., Ouerdani I., Pillet S. et al. Direct typing of human enteroviruses from wastewater samples. J. Virol. Methods., 2014, vol. 207, pp. 215-219.
  11. Iturriza-Gomara M., Megson B., Gray J. Molecular detection and characterization of human enteroviruses directly from clinical samples using RT-PCR and DNA sequencing. J. Med. Virol., 2006, vol. 78, pp. 243-253.
  12. Ge S., Yan Q., He S. et al. Specific primer amplification of the VP1 region directed by 5' UTR sequence analysis: enterovirus testing and identification in clinical samples from hand-foot-and-mouth disease patients. J. Virol. Methods., 2013, vol. 193, pp. 463-469.
  13. Hu L., Zhang Y., Hong M. et al. Phylogenetic evidence for multiple intertypic recombinations in enterovirus B81 strains isolated in Tibet, China. Scientific reports., 2014, vol. 12.
  14. Tsai C.S., Yang Y.H. et al. Association of Tic Disorders and Enterovirus Infection: A Nationwide Population-Based Study. Medicine., 2016, vol. 95.
  15. Thoelen I., Lemey P., I. Van der Donck et al. Molecular typing and epidemiology of enteroviruses identified from an outbreak of aseptic meningitis in Belgium during the summer. J. Med. Virol., 2000, vol. 70, pp. 420-429.
  16. Xiang Z., Gonzalez R., Xie Z. et al. Human rhinovirus C infections mirror those of human rhinovirus A in children with community-acquired pneumonia. J. Clin. Virol., 2010, vol. 49, pp. 94-99.
  17. Tapparel C., Junier T., Gerlach D. et al. New respiratory enterovirus and recombinant rhinoviruses among circulating picornaviruses. Emerg Infect Dis., 2009, vol. 15, pp. 719-726.
  18. Simmonds P., Welch J. Frequency and dynamics of recombination within different species of human enteroviruses. J. Virol., 2006, vol. 80, pp. 483-493.
  19. Dumaidi K., Al-Jawabreh A. Molecular detection and genotyping of enteroviruses from CSF samples of patients with suspected sepsis-like illness and/or aseptic meningitis from 2012 to 2015 in West Bank, Palestine. PLoS One., 2017, vol. 22, pp. 12.
  20. Li J., Sun Y., Du Y., Yan Y. et al. Characterization of Coxsackievirus A6- and Enterovirus 71-Associated Hand Foot and Mouth Disease in Beijing, China, from 2013 to 2015. Front. Microbiol., 2016, vol. 30, pp. 391.
  21. Flett K., Youngster I., Huang J. et al. Hand, foot, and mouth disease caused by coxsackievirus a6. Emerg. Infect. Dis., 2012, vol. 18, pp. 1702.
  22. Chen P., Tao Z., Song Y. et al. A coxsackievirus B5-associated aseptic meningitis outbreak in Shandong Province, China in 2009. J. Med. Virol., 2013, vol. 483, pp. 85.

 

5'-NTR АУДАНЫН ТАЛДАУ НЕГІЗІНДЕ АДАМ ЭНТЕРОВИРУСЫН АНЫҚТАУҒА АРНАЛҒАН ПТР ХАТТАМА ӘЗІРЛЕУ ЖӘНЕ ОНЫ МОЛЕКУЛАЛЫҚ ЭПИДЕМИОЛОГИЯДА ҚОЛДАНУ

Камалова Д.К.1, Куйбагаров М.А.1, Абеев А.Б.2, Шведюк В.Б.1, Балықбаев Қ.О.2, Қиянбекова Л.С.2, Аушахметова З.Т.2, Шевцов А.Б.1
1Ұлттық биотехнология орталығы,
Қорғалжын тас жолы, 13/5, Астана, 010000, Қазақстан
2Ұлттық сараптама орталығы,
Желтоқсан к-сі, 46,Aстана, 010000, Қазақстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Энтеровирус инфекциясы дүние жүзінде кеңінен тараған және денсаулық сақтау саласында өзекті мәселе туындатады.Энтеровирустық инфекцияның клиникалық көрінісі көп және өте ауыр асқынуға, кейде өлімгі дейін әкеп соқтыруы мүмкін. Энтеровирусты ПТР әдісімен жедел диагностикалау және генотипирлеуі эпидемиологиялық жағдайды бақылап індеттің ауыр күйін болжауға мүмкіндік береді.  Қазақстанда энтеровирусты диагностикалауға арналған отандық ПТР тест-жүйелер жоқ және айналымда жүрген генотиптерге жиі мониторинг жүргізілмейді. Бұл зерттеу 5' таратылмайтын аудан (5' NTR) фрагментін амплификациялау негізінде энтеровирусты анықтауға және Қазақстанда 2016-2017 жылдары айналымда болған энтеровирустарды генотиптеу барысында оны секвенерлеуге арналаған ПТР хаттама әзірлеуге бағытталған. Зерттеу барысында барлығы 74 кДНҚ үлгісі қолданылды. Әзірленген хаттаманы қолдану арқылы алынған нәтиженің 97,3% коммерциялық ПТР тест-жүйе нәтижелерімен сәйкес келді. Әзірленген хаттаманың артықшылығы, амплифицирленетін фрагментті секвенерлеу әдісімен энтеровирустарды генотиптеу болып табылады. Барлығы генотиптелген 59 үлгі, оның 54,7% энтеровирус B, ал 35,9% энтеровирус А және 1,56% С тобына жатқызылды.

Менингитпен байланысты генотиптердің тоқсан үш пайызы энетровирус В ретінде теңестірілді және Е-9, Е-18, CV-B5 және Е-30 болып кластерленді. Энтеровирус инфекциясы бар науқастардан бөліп алынған кДНҚ үлгілері CV-A6 генотипімен кластерленді.  

Негізі сөздер: энтеровирус, ПТР, генотипирлеу, 5' NTR аудан, серозды менингит, ішек инфекциясы.