4/2017
Gritsenko D.A., Deryabina N.D., Galiakparov N.N.
Institute of plant biology and biotechnology,
Timiryazev str., 45, Almaty, 050040, Kazakhstan
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

Grapevine virus A belongs to the Vitivirus genus. Grapevine virus A is involved in the etiology of Kober stem grooving, a disease of the grapevine rugose wood complex.  The grapevine virus A genome (7.4 kb) consists of five open reading frames. The ORF2 function is not currently investigated. We attempted to develop a vector, based on grapevine virus A by cloning the gene encoding the capsid protein of apple chlorotic leaf spot virus in ORF2. Modification of grapevine virus A genome has not affected amplification or movement of virus through the plant. Symptoms of infection were detected 6-7 day after agroinfiltration. Nevertheless, immunoblotting has not detected the capsid protein of the capsid protein of apple chlorotic leaf spot virus either in the infiltrated leaves or in the upper leaves on the 15th day after agroinfiltration. It may be explained by the weak subgenomic ORF2 promoter. In addition, the genetic stability of modified grapevine virus A after K gene insertion was confirmed.

Key words: Grapevine virus A, ORF2, capsid protein, movement protein, apple chlorotic leaf spot virus.


УДК 577.21

 

МОДИФИКАЦИЯ ГЕНОМА ВИРУСА А ВИНОГРАДА

Гриценко Д.А., Дерябина Н.Д., Галиакпаров Н.Н.
Институт биологии и биотехнологии растений,
ул. Тимирязева, 45, Алматы, 050040, Республика Казахстан
d
.kopytina@gmail.com

 

АБСТРАКТ

Вирус А винограда относится к роду Vitivirus. Вирус А винограда участвует в развитии комплексного заболевания бороздчатости древесины винограда. Геном вируса А винограда (7.4 тыс.п.н) состоит из 5 открытых рамок считывания. Функция ОРС2 в настоящий момент не установлена. Путем клонирования гена, кодирующего капсидный белок вируса хлоротической пятнистости листьев яблони, в ОРС2 были произведены попытки по разработке вектора на основе вируса А винограда. Модификация генома вируса А винограда по ОРС2 не вызвала нарушений процессов амплификации и передвижения вируса по растению. Симптомы заражения вирусом были зафиксированы на 6-8 день после агроинфильтрации. Тем не менее, с помощью иммуноблоттинга мы не смогли обнаружить капсидный белок вируса хлоротической пятнистости листьев яблони ни в инфильтрованных листьях, ни в верхних листьях на 15 день после агроинфильтрации, что, возможно, связано cо слабым субгеномным промотором ОРС2. Помимо прочего, мы подтвердили генетическую стабильность модифицированного вируса А винограда при инсерции гетерологичного гена в ОРС2.

Ключевые слова: Вирус А винограда, ОРС2, капсидный белок, белок передвижения, вирус хлоротической пятнистости листьев яблони.


ВВЕДЕНИЕ

Вирус А винограда (ВАВ) относится к роду Vitivirus. ВАВ участвует в развитии комплексного заболевания бороздчатости древесины винограда [1-4]. В природе ВАВ переносится несколькими видами мучнистых червецов, относящихся к роду Planococcus и Pseudococcus [5-7]. Вирусная частица ВАВ имеет филаментозную форму длиной около 800 нм[8]. Геном ВАВ (7.4 тыс.п.н) состоит из 5 открытых рамок считывания (ОРС)[9-10]. ОРС1 кодирует репликазу, ОРС2 кодирует белок неизвестного строения и функции, ОРС3 – белок передвижения, ОРС4 –капсидный белок и ОРС5 кодирует белок Р10, который является супрессором РНК-интерференции и участвует в развитии симптомов при заражении [11-13]. С целью определения функции ОРС2 была осуществлена делеция большей ее части, между AccI рестрикционными сайтами. В итоге было выявлено, что делеция ОРС2 не влияет на амплификацию вируса. Делеция ОРС2 повлияла на накопление субгеномной РНК для ОРС3 и, соответственно, на количество белка передвижения [14]. Так как 3’-конец ОРС2 перекрывается с 5’-концом ОРС3, который кодирует белок передвижения, возможно, делеция в 65 нуклеотидов выше старт-кодона ОРС3 повлияла на связывание РНК-зависимой РНК-полимеразы с предположительным субгеномным промотором ОРС3. В настоящий момент не было произведено каких-либо клонирований гетерологичных генов в ОРС2 и изучение их влияния на экспрессию вируса. Отсутствие влияния делеции ОРС2 на амплификацию вируса и его передвижение может быть рассмотрено как возможность создания вектора на основе вируса А винограда путем клонирования гетерологичных генов в ОРС2. Вирусы растений в настоящий момент широко используются для создания векторов для транзиентной экпрессии гетерологичных белков в растениях. Использование векторов на основе вирусов растений дает ряд преимуществ: отсутствие патогенов общих с животными, нет необходимости в особых условиях выращивания растений по сравнению с культивированием клеток животных, достаточно небольших площадей для получения высоких количеств целевого продукта, быстрое масштабирование производства [15]. В данной работе мы осуществили клонирование гена, кодирующего капсидный белок вируса ВХПЛЯ (вирус хлоротической пятнистости листьев яблони) в ОРС2. Для клонирования гетерологичного гена104 нуклеотида, локализованных на 5’-конце ОРС2, были удалены. Кроме того, была изучена стабильность экспрессии вируса модифицированного по ОРС2в Nicotiana benthamiana.

 

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы бактерий и вектора

Штаммы бактерий: Escherichia coli(DH5), Agrobacterium tumefaciens (EHA 105).pCASSgva вектор использовался для создания pCAMgvaК вектора.

Плазмиды: pCAMBIA2300, pGEM(N)- pGEM3zf + без рестрикционного сайта NdeI, T-pGEM3zf + [19].

Реагенты

Реагенты для выполнения работы были производства Sigma-Aldrich и Thermo Scientific.

 

Клонирование гетерологичного гена в ОРС2

Для модификации генома ВАВ по ОРС2 был использован вектор pCASSgva, несущий полный геном ВАВ (вектор был разработан ранее Галиакпаровым Н. и предоставлен для модификации). Схема создания вектора изображена на рисунке 2. Вектор pCASSgva был расщеплен по сайтам AatII с получением последовательности, содержащей ОРС2-ОРС5 и 35ST (рис. 1). Один сайт AatII расположен в ОРС1 на 3’-конце, второй после 35S терминатора. Далее полученная последовательность была клонирована в pGEM(N) плазмиду. В итоге был получен вектор, маркированный как pGGVA (рис.2). Полученный вектор pGGVA использовали для внесения рестрикционных сайтов NdeI в ОРС2 методом ПЦР-опосредованного мутагенеза при использовании праймеров 2015053 прямого (5-AAGTTGTACAGAGTTGGTTGAGCATATGAGTCAGGGTGGT) и 2015051 обратного (5-ACTCTGTACAACTTTGCGATGTCATTACTCAAAAAGTC-3).

 
Рис. 1. Схематическое изображение вектора pCASSgva
Fig. 1.Schematic representation of pCASSgva vector

 

 
Рис. 2. Схематическое изображение стратегии разработки вектора pCAMgvaK
Fig. 2.Schematic representation o fstrategy of pCAMgvaKvector development

 

ПЦР проводили с использование Pfu-полимеразы в следующих условиях: 25 мкл реакционной смеси содержало 2.5 мкл 10Х Pfu Буфера (200 мМ Tris HCl, pH 8.8, 100мМ (NH4)2SO4,100 мМ КСl, 1 мг/млBSA, 1% TritonX-100), 2.5 мМ MgSO4, 0.2 мМ дНТФ, 2 мМ каждого праймера, 2.5 ед. Pfu-полимеразы и 30 нг плазмиды pGGVA. Амплификацию проводили в следующем режиме: первоначальная денатурация при 94оС в течение 2 мин, 25 циклов, состоящих из денатурации при 94оС – 20 сек., отжига праймеров при 54оС– 30 сек. и элонгации при 72оС – 4 мин. После 25 циклов проводилась финальная элонгация при 72оС в течение 15 мин. После амплификации 2 мкл реакционной смеси наносили в 1% агарозный гель для анализа продуктов амплификации. Оставшуюся реакционную смесь подвергали гидролизу эндонуклеазой DpnI. Эндонуклеаза рестрикции DpnI гидролизует последовательность 5’-GATC-3’ только при наличии метилированного основания гуанидина [17]. Отсутствие метилирования в продукте ПЦР препятствует расщеплению ДНК, но происходит расщепление плазмиды, которая выступала в роли матрицы. Реакцию проводили в 30 мкл реакционной смеси, содержащей буфер DpnI (Thermo Scientific), 23 мкл ПЦР-продукта, 5 ед. эндонуклеазы DpnI при 37оС в течение 1 часа, с последующей инактивацией фермента при 80оС в течение 20 минут. Интактная ДНК ПЦР-продукта очищалась и подвергалась самолигированию в 10 мкл реакционной смеси, содержащей 1х Т4 буфера лигазы (Thermo Scientific), 150 нг очищенного ПЦР-продукта и 5 ед. Т4 ДНК лигазы (Thermo Scientific). Реакционная смесь, после инкубации при +4оС в течение 14 часов, использовалась для трансформации бактерий. Полученный вектор был маркирован как pGGVA (NdeI). В данный вектор по сайтам NdeI и EcorV был субклонирован ген, кодирующий капсидный белок вируса ВХПЛЯ, в дальнейшем ген обозначается как К-ген. К-ген был субклонирован из вектора pGEMK2 [18]. После субклонирования К-гена в вектор pGGVA (NdeI) был получен вектор pGGVAК. Далее из вектора pGGVAК модифицированная нуклеотидная последовательность ВАВ была вырезана по сайтам aatII и SalI с последующим субклонированием в вектор pCAMgva [19]. В итоге был получен вектор pCAMgvaK, который несет модифицированный геном вируса А винограда.

Отобранные клоны вектора pCAMgvaK были анализированы методом секвенирования при использовании праймера Dil1(5’-ATATAGACGTCGATGCTCAGCAAG-3’) для проверки отсутствия ошибок в гене К и на 5’-конце ОРС2. Секвенирование проводили с использованием набора реагентов BigDye Terminator v3.1 Cycle Sequencing Kit, POP-4® полимера на секвенаторе ABI PRISM® 310 Genetic Analyzer (Applied Biosystems).

 

Трансформация агробактерий вектором pCAMgvaK

Компетентные клетки агробактерий (штамм ЕНА105) были трансформированы конструкцией pCAMgvaK с использованием модифицированного метода замораживания/оттаивания [20].

Модифицированный протокол трансформации агробактерий (замораживание/оттаивание) выполнялся в следующей последовательности: к 100 мкл компетентных клеток добавлялся вектор в концентрации 1 мкг, далее производили инкубацию в течение 10 минут во льду. После инкубации во льду смесь замораживали в предварительно охлажденном спирте (96%) на -80°С в течение 5 мин. Далее пробирка со смесью инкубировалась при комнатной температуре в течение 7 минут с последующим добавлением 1 мл ЛБ (Луриа-Бертани) среды. После добавления ЛБ среды клетки инкубировали в термошейкере с перемешиванием в течение 2 часов при 28°С. Далее агробактерии осаждались центрифугированием при 4 тыс. об.в течение 5 мин, супернатант сливали, а осадок разбавляли в 50 мкл ЛБ среды и наносили на чашки Петри, содержащие агаризированную среду ЛБ с антибиотиками (канамицин(50 мг/л) и рифампицин(25 мг/л). Отобранные колонии агробактерий проверялись на наличие конструкции методом ПЦР с праймерами К1 и К2 [21].

 

Агроинфильтрация растений

Отобранные колонии агробактерий, несущие конструкцию pCAMgvaK, были заморожены в 15% глицерине при -80°С. Инокуляция агробактерий из глицеринового стока производилась в размере одной полной петли в ЛБ среду с канамицином и рифампицином. Инокулированные агробактерии выращивали 12 часов при 28°С в термошейкере. После чего клетки осаждались центрифугированием при 4 тыс. оборотов в течение 5 минут и осадок разводился в 1 мл МС (Мурасиге-Скуга) среде, содержащей ацетосирингон (0,2 мМ). Далее проводили осаждение при тех же условиях. Полученный осадок разводился в среде МС+ацетосирингон (0,2 мМ) до достижения ОД 0,3. Разведенный осадок инкубировали в течение 4 часов при комнатной температуре в темноте. После чего проводили агроинфильтрацию растений табака с помощью шприцов без иголок. Агроинфильтрации подвергались растения, имеющие 4-6 листьев. Заражались 2 нижних листа напротив друг друга.

 

Выделение РНК и обратная транскрипция

РНК из верхних листьев зараженных растений выделялась на 15 день после агроинфильтрации с помощью набора реагентов Thermo Scientific kit (Gene JET Plant RNA Purification Kit). Обратная транскрипция (ОТ) была выполнена в 2 этапа. 1 этап– инкубация с праймерами:13 мкл реакционной смеси (1 мкл (150 нг) общей РНК; 1 мкл (10мМ) специфичного обратного праймера для каждого гена, 11 мкл бидисциллированной воды) инкубировали в течение 10 мин при 65°С. Далее реакционную смесь охлаждали во льду в течение 5 мин.2 этап– обратная транскрипция: 4 мкл 5х буфера для ревертазы (250 мМ Tris-HCl (pH 8.3 at 25°C), 250 мМ KCl, 20 мМ MgCl2, 50 мМ DTT), 2мклдезоксинуклеотидов (10мМ dNTP смесь) и 1 мкл(200U) обратной транскриптазы (Revert Aid H Minus Reverse Transcriptase) были добавлены к 13 мкл реакционной смеси, полученной на 1 этапе. Полученную реакционную смесь после 2 этапа инкубировали при 42°С в течение 1,5 часа. В дальнейшем кДНК была использована для ПЦР со специфичными прямым и обратным праймерами для каждого гена (таблица 1).

 

Таблица 1. Список праймеров
Table 1. List of primers

Название праймера

 

Name of primer

Последовательность 5’-3’

 

Sequence 5’-3’

Обратная транскрипция

 

Reverse transcription

ПЦР

 

PCR

201269

 

AAACTCGAGTATCTCGACAGCCTGCTCA

+

Обратный праймер для амплификации ОРС4

 

Reverse primer for ORF4 amplification

201216

CGGGTACATCGCCTTGGTCGG

 

Прямой праймер для амплификации ОРС4

 

Forward primer for ORF4 amplification

К2

ACA GAC TCG AGG CAA AGA TCA GTT GAA AC

+

Обратный праймер для амплификация К

 

Reverse primer for K amplification

К1

GAA GGC ATA TGG CAG CAG TTC TGA ACC TGC A

 

Прямой праймер для амплификации К

 

Forward primer for K amplification

МР2

CAAAGGATCCGCAAACAATGTCGCACGGAGATTCTCA

+

Обратный праймер для амплификация ОРС3

 

Reverse primer for ORF3 amplification

МР1

GGTCGGAGCTCCTTTCGGATGCGTCCTCAG

 

Прямой праймер для амплификации ОРС3

 

Forward primer for ORF3 amplification

 

Выделение белков и вестерн блоттинг

Белки из нижних инфильтрированных листьев на 3-4 день и из верхних неинфильтрированных листьев на 15 день после агроинфильтрации были выделены методом, описанным в статье Rubinson E.et. al. [22]. Иммуноблоттинг был выполнен при использовании первичных антител к капсидному белку ВАВ (Bioreba) и первичных антител к капсидному белку ACLSV(Bioreba). Антитела к иммуноглобулину G кролика (Anti-Rabbit IgG (whole molecule)–AlkalinePhosphatase (Sigma-Aldrich) были использованы как вторичные антитела [22].

 

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

Модификация генома вируса А винограда

Клонирование К-гена осуществлялось в область ОРС2 путем замены ее 104 п.н на 5’-конце. Клонирование было выполнено по сайтам NdeI и EcorV. Так как геном ВАВ состоит из перекрывающихся рамок считывания, внесение гетерологичных генов затрудняется рядом причин. Прежде всего, необходимо сохранить целостность перекрывающихся областей. Модификация данных областей приводит к проблемам транскрипции и трансляции белков, кодируемых перекрывающимися ОРС. Для сохранения целостности области перекрытия ОРС2 с ОРС1, ген К был клонирован в рамке считывания с последовательностью ОРС2, которая перекрывается с ОРС1 (рис. 3). Делеция большей части ОРС2, исключая 65 нуклеотидов выше старт-кодона ОРС3, как было описано во введении, повлияло на накопление как субгеномной РНК, так и белка ОРС3. Ввиду чего нуклеотидная последовательность ОРС2 в размере 336 нуклеотидов перед старт-кодоном ОРС3 оставалась интактной. Последовательность ОРС2 на ее 3’-конце (336 п.н) оставалась не тронутой с целью предотвращения влияния инсерции гетерологичного гена на связывания РНК-зависимой РНК-полимеразы с ОРС3 субгеномным промотором. Субгеномный промотор ОРС3 располагается на 3’-конце последовательности ОРС2. Инсерция К-гена привела к выключению экспрессии ОРС2. Ген К находился под контролем субгеномного промотора ОРС2. Предположительный субгеномный промотор находится на 3’-конце ОРС1 перед старт-кодоном ОРС2 [10]. Старт-кодон ОРС2 являлся начальным кодоном в трансляции белка К. При экспрессии белка К на его N-конце дополнительно находилось 12 аминокислот белка ОРС2 (последовательность области перекрытия). Нуклеотидные последовательности гена К и 5’-конца ОРС2 были проверены на наличие ошибок методом секвенирования.

 
Обозначения: желтым цветом выделен участок перекрытия ОРС1 и ОРС2; коричневым цветом выделен участок перекрытия ОРС2 и ОРС3. Серой стрелкой отмечена трансляция белка К, сшитого с N-концом белка, кодируемого ОРС2 (область перекрытия ОРС1 и ОРС2). Трансляция К белка изображена в аминокислотной последовательности. Красным цветом отмечены аминокислоты, кодируемые ОРС2 (область перекрытия ОРС2 с ОРС1). Метионин, кодируемый старт-кодоном гена К выделен в черном квадрате.
Рис. 3. Схематическое изображение трансляции гена K
The overlapping region of ORF1 and ORF2 is highlighted in yellow color; the overlapping region of ORF2 and ORF3 is highlighted in brown color. The gray arrow marks the translation of K protein fused with the N-terminus of the protein encoded by ORF2 (the overlapping region of ORF1 and ORF2). Translation of K protein is represented in the amino acid sequence. Red color indicates amino acids encoded by ORF2 (the overlapping region of ORF2 with ORF1). Methionine, encoded by the start codon of gene K, is isolated in a black square.
Fig. 3. Schematic representation of K protein translation

 

Результаты агроинфильтрации растений

 

Трансформированные агробактерии конструкцией pCAMgvaK проверялись на наличие конструкции методом ПЦР при использовании праймеров К1 и К2. Отобранными клонами осуществляли агроинфильтрацию нижних листьев табака растений, имеющих 4-6 листьев. На 4 день после агроинфильтрации из инфильтрированных листьев растений Nicotiana benthamiana выделялись белки и анализировались на наличие белка оболочки вируса ВХПЛЯ. Иммуноблоттинг не показал наличие белка, что, возможно, связано с малой концентрацией белка. На 7-8 день были визуализированы первые симптомы заражения в виде появления некротических желтых жилок на верхних листьях растений и их скручивание.

Из верхних листьев на 15 день после агроинфильтрации были выделены РНК и белки (рис.4). Отбирались листья с симптомами заражения. Выделенная РНК использовалась в обратной транскрипции с последующей ПЦР (ОТ-ПЦР) (рис.5). С помощью праймеров к гену К было подтверждено, что геном вируса содержит гетерологичный ген, не произошла элиминация гена в процессах амплификации и передвижения вируса.

 
А – изображение табака после агроинфильтрации бактериями, несущими вектор pCAMgva; Б – изображение табака после агроинфильтрации бактериями, несущими вектор pCAMgvaK; В – изображение табака после агроинфильтрации бактериями, несущими вектор pCAMBIA2300 (пустая плазмида)
Рис. 4. Изображение табака на 14 день после агроинфильтрации
A – N.benthamiana agroinfiltrated by bacteria carrying pCAMgva vector; B – N.benthamiana agroinfiltrated by bacteria carrying pCAMgvaK vector; B – the image of N.benthamiana agroinfiltrated by bacteria carrying the pCAMBIA2300 (empty plasmid) vector
Fig. 4. Plants on 14 day after agroinfiltration

 

 
А – ОТ-ПЦР со специфическими праймерами к гену К: 1 – отрицательный контроль (РНК, выделенная из незараженного растения); 2 – РНК, выделенная из верхних листьев зараженного растения на 15 день после агроинфильтрации. Б – ОТ-ПЦР со специфическими праймерами к гену, кодирующего капсидный белок ВАВ: 1 – отрицательный контроль (РНК, выделенная из незараженного растения); 2 – РНК, выделенная из верхних листьев зараженного растения на 15 день после агроинфильтрации (конструкция pCAMgvaK); 3 – РНК, выделенная из верхних листьев зараженного растения на 15 день после агроинфильтрации (конструкция pCAMgva).В – ОТ-РЦР со специфическими праймерами к гену, кодирующего белок передвижения ВАВ: 1 – отрицательный контроль (РНК, выделенная из незараженного растения); 2 – РНК, выделенная из верхних листьев зараженного растения на 15 день после агроинфильтрации (конструкция pCAMgvaK); 3 – РНК, выделенная из верхних листьев зараженного растения на 15 день после агроинфильтрации (конструкция pCAMgva)
Рис. 5. Изображение результатов электрофореза в 1% агарозном геле ОТ-ПЦР
A – RT-PCR with specific primers for K gene: 1 – negative control (RNA isolated from uninfected plant); 2 – RNA isolated from the upper leaves of the infected plant on day 15 after agroinfiltration. Б– RT-PCR with specific primers for coat protein gene: 1 – negative control (RNA isolated from uninfected plant); 2 – RNA isolated from the upper leaves of the infected plant on day 15 after agroinfiltration (pCAMgvaK construction); 3 – RNA isolated from the upper leaves of the infected plant on day 15 after agroinfiltration (pCAMgva construction). B –RT-PCR with specific primers for movement protein gene: 1 – negative control (RNA isolated from uninfected plant); 2 – RNA isolated from the upper leaves of the infected plant on day 15 after agroinfiltration (pCAMgvaK construction); 3 – RNA isolated from the upper leaves of the infected plant on day 15 after agroinfiltration (pCAMgva construction)
Fig.5. Results of RT-PCR for genes encoding K protein, coat protein and movement protein 

 

Кроме того, нами была осуществлена ОТ-ПЦР на ген капсидного белка вируса А винограда и на ген белка оболочки. Результаты показали, что инсерция гена в ОРС2 не повлияла на накопление общей РНК как для гена капсидного белка, так и для гена белка оболочки модифицированного вируса по сравнению с накоплением РНК вируса дикого типа. Уровень экспрессии капсидного белка ВАВ при агроинфильтрации растений созданным вектором не отличался от уровня экспрессии капсидного белка при заражении вектором, несущим немодифицированный геном ВАВ (рис. 6).

 
А – изображение результатов иммуноблоттинга на капсидный белок ВАВ, выделенный на 4 день после агроинфильтрации из зараженных листьев: 1 – белки из инфильтрированных листьев (конструкция pCAMgvaK); 2 – белки из инфильтрированных листьев (конструкция pCAMgva); 3 – белки из инфильтрированных листьев (плазмида pCAMBIA 2300). Б – изображение результатов иммуноблоттинга на капсидный белок, выделенный на 15 день после агроинфильтрации из верхних листьев: 1 – белки из верхних листьев растения, нижние листья которого были инфильтрированы плазмидой pCAMBIA 2300; 2 – белки из верхних листьев растения, нижние листья которого были инфильтрированы конструкцией pCAMgva; 3 – белки из верхних листьев растения, нижние листья которого были инфильтрированы конструкцией pCAMgvaK
Рис. 6. Изображение результатов иммуноблоттинга на экспрессию капсидного белка ВАВ
A – the results of immunoblotting for coat protein isolated from infected leaves on 4 day after agrofiltration: 1 – protein isolated from infiltrated leaves (pCAMgvaK construction); 2 – protein isolated from infiltrated leaves (pCAMgva construction); 3 – protein isolated from infiltrated leaves (pCAMBIA 2300 vector). Б – the results of immunoblotting for coat protein isolated from upper leaves on 15 day after agrofiltration: 1 – protein isolated from infiltrated leaves (pCAMBIA 2300 vector); 2 – protein isolated from infiltrated leaves (pCAMgva construction); 3 – protein isolated from infiltrated leaves (pCAMgvaK construction)
Fig. 6. Western blot analysis of coat protein expression

 

Тем не менее, нам не удалось с помощью иммуноблоттинга подтвердить наличия К белка в верхних листьях на 15 день после агроинфильтрации. Мы предполагаем, что отсутствие белка может быть связано со слабым субгеномным промотором ОРС2, низкая концентрация не детектируется иммуноблоттингом. Кроме того, возможно наличие на N-конце К белка аминокислотной последовательности белка ОРС2 приводит к нестабильности капсидного белка вируса ВХПЛЯ. Была проверена генетическая стабильность модифицированного вируса путем инфицирования здорового растения вытяжкой из зараженного растения. Лист зараженного растения массой в 100 мг гомогенизировался в фосфатном буфере и вытяжка объемом в 100 мкл смешивалась с керамзитом для механической инокуляции. Смесь помещалась на поверхность листа здорового растения и осторожно втиралась до появления легких повреждений. Механической инокуляции подвергались 2 листа напротив друг друга. Через 7-8 дней появлялись первые симптомы заражения. На 15 день из зараженных растений были выделены РНК и белки. С помощью ОТ-ПЦР было подтверждено наличие К-гена в геноме вируса, что говорит о генетической стабильности модифицированного вируса. Капсидного белка вируса ВХПЛЯ не было обнаружено при проведении иммуноблоттинга. 

 

ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ

Создание векторов на основе вирусов растений не теряет актуальности ввиду ряда причин, среди которых на первое место выдвигается количество целевого продукта. В настоящий момент известны вирусы, которые пригодны для получения целевых продуктов в растениях. К ним относят вирус табачной мозаики, X вирус картофеля, вирус мозаики коровьего гороха. Кроме того, известны вектора на основе вирусов, содержащих ДНК геном (Bean yellow dwarf virus). Поиск универсального вектора для экспрессии гетерологичных генов для медицины и сельского хозяйства с повышенной и стабильной экспрессией белка является основной задачей в инженерии векторов. Для разработки вектора был модифицирован геном ВАВ по ОРС2 с целью изучения возможности экспрессии гетерологичных генов под ОРС2 субгеномным промотором. Мы подтвердили, что вирус передвигается по растению и инсерция гена капсидного белка ВХПЛЯ в геном ВАВ не влияет на накопление РНК капсидного белка и белка оболочки вируса А винограда. Тем самым подтвердили, что делеция ОРС2 между рестрикционными сайтами AccI, как было ранее описано Галиакпаровым Н.Н., повлияла на связывание субгеномного промотора ОРС3 и РНК-зависимой РНК-полимеразой. Кроме того, подтвердили экспрессию капсидного белка вируса А винограда, которая не отличается от экспрессии капсидного белка при заражении немодифицированным геномом вируса. Тем не менее, не было отмечено наличие капсидного белка вируса ВХПЛЯ методом иммуноблоттинга, ни в инфильтрированных листьях, ни в верхних листьях на 15 день после агроинфильтрации. Отсутствие белка может быть связано с рядом причин, прежде всего со слабым субгеномным промотором ОРС2, несмотря на то, что результаты ОТ-ПЦР показывают наличие продукта для гена К, соизмеримым по количеству с результатами для гена, кодирующего капсидный белок ВАВ. Ранее работы по детекции белка, кодируемого ОРС2, не проводились. В настоящий момент структура и свойства белка, кодируемого ОРС2, не известны [14]. Не обнаружено каких-либо гомологий на нуклеотидном и аминокислотном уровнях с последовательностей ОРС2 в базе данных NCBI. Для экспрессии гетерологичных генов данная стратегия внесения целевого гена не подходит, необходимо внесение дополнительного промотора перед целевым геном либо внесение гена в другой участок генома вируса. Вирус содержит открытые рамки считывания, перекрывающиеся между собой, что затрудняет задачу создания вектора без нарушения целостности генома и целевого гена. Возможно внесение гена между ОРС4 и ОРС5, данные ОРС не перекрываются, но проблема возникает в том, что субгеномный промотор для ОРС5 не определен и внесение гена может привести к нарушению экспрессии белка ОРС5. Данный белок важен как супрессор РНК-интерференции и отвечает за развитие симптомов заражения [13]. В настоящий момент не известно работ по исследованию ОРС2 как мишени для внесения генов в целях создания вектора на основе вируса А винограда. 

 

Финансирование

Исследование выполнено при финансовой поддержке Министерства образования и науки Республики Казахстан в рамках проекта «Разработка вирусного вектора для получения рекомбинантных белков в растениях» (1334/ГФ4).

 

REFERENCES

 

  1. Martelli G.P., Minafra A. and Sardarelli P. Vitivirus, a new genus of plant viruses. Archives of Virology,1997, vol. 142, рр. 1929-1932. 9672652.
  2. Chevalier S., Greif C., Bass E. and Walter B. Investigations on the aetiology of Kober stem grooving.Extended Abstracts, XIth ICVG Meeting (Nyon, Switzerland), рр.49-49.
  3. Conti M., Milne R.G., Luisoni E. and Boccardo G. A closterovirus from a stem-pitting diseased grapevine. Phytopathology, 1980, vol. 79, рр.394-399.
    CrossRef
  4. Garau R., Prota U., Piredda R. and Boscia D. On the relationship between Kober stem groovi ng and grapevine virus A. Vitis, 1994, vol. 33, рр. 161-163.
  5. Engelbrecht D.J., Kasdorf G. Occurrence and transmission of grapevine virus A in South African grapevines.S Afr J Enol Vitic, 1987,vol. 8, рр.23-29.
    CrossRef
  6. Garau R., Prota V.A., Boscia D., Fiori M., ProtaU. А new vector of trichoviruses A and B.Vitis, 1995,vol. 34, рр. 67-68.
  7. Rosciglione B., Castellano M.A., Martelli G.P., Savino V., Cannizzaro G. Mealybug transmission of grapevine virus A.Vitis, 1983,vol. 22, рр.331-347
    CrossRef
  8. Tanne E., Ben-Dov Y., Raccah B. Transmission of the corky-bark disease by the mealybug Planococcusficus.Phytoparasitica, 1989, vol. 17, рр.55.
    CrossRef
  9. Galiakparov N., Tanne E., Sela I., Gafny R. Infectious RNA transcripts from Grapevine virus A cDNA clone.Virus Genes, 1999,vol. 19, рр.235-242.
    CrossRef
  10. Galiakparov N., Goszczynski D.E., Che X., Batuman O., Bar-Joseph M.,Mawassi M. Two classes of subgenomic RNA of grapevine virus A produced by internal controller elements.Virology, 2003, vol. 312,рр.434-448.
    CrossRef
  11. Chiba M., Reed J.C., Prokhnevsky A.I., Chapman E.J., Mawassi M., Koonin E.V., Carrington J.C., Dolja V.V. Diverse suppressors of RNA silencing enhance agroinfection by a viral replicon. Virology, 2006, vol. 346, рр.7-14.
    CrossRef
  12. Zhou Z.Sh., Dell’Orco M., Saldarelli P., Turturo C., Minafra A., Martelli G.P. Identification of an RNA-silencing suppressor in the genome of Grapevine virus A. Journal of General Virology, 2006,vol. 87, рр. 2387-2395.
    CrossRef
  13. Haviv S., Iddan Y., Goszczynski D.E., Mawassi M.  The ORF5 of Grapevine virus A is involved in symptoms expression in Nicotiana benthamiana plants. Annals of applied biology,2012, vol. 160, рр.181-190.
    CrossRef
  14. Galiakparov N., Tanne E., Sela I., Gafny R. Functional analysis of the grapevine virus A genome. Virology, 2003, vol. 306, рр.42-50.
    CrossRef
  15. Gleba Y.Y., Tusé D., Giritch A. Plant viral vectors for delivery by Agrobacterium.Curr Top Microbiol Immunol, 2014,vol. 375, рр. 155-192.
    CrossRef
  16. Haviv S., Galiakparov N., Goszczynski D.E., Batuman O., Czosnek H., Mawassi M. Engineering the genome of Grapevine virus A into a vector for expression of proteins in herbaceous plants. J Virol Methods, 2006, vol. 132, рр. 227-231.
    CrossRef
  17. Lacks S., Greenberg B. Complementary specificity of restriction endonucleases of Diplococcus pneumoniae with respect to DNA methylation. J. Mol. Biol.114, 1997, рр. 153-168. 20509.
  18. Gritsenko D.A., Kenzhebekova R.T., Deryabina N.D.,Galiakparov N.N. CozdanieT-vektora dlya pryamogo klonirovaniya PTsR-produktov. Eurasian journal of applied biotechnology, 2016, vol. 4, pp.43-50.
    CrossRef
  19. Kopytina D.A., Galiakparov N.N. Izuchenie sposobnosti virusa A vinograda infitsirovat Nicotiana benthamiana pri agrobakterialnoy infiltratsii.Vestnik KazNU, 2014, vol. 1, pp. 195-199.
  20. Wise A.A.1, Liu Z., Binns A.N. Three methods for the introduction of foreign DNA into Agrobacterium. Methods Mol Biol., 2006, vol. 343, рр. 43-53.
    CrossRef
  21. Teimourpour R., Sadeghian A., Meshkat Z., Esmaelizad M., Sankian M., Jabbari A.R. Construction of a DNA Vaccine Encoding Mtb32C and HBHA Genes of Mycobacterium tuberculosis. Jundishapur J Microbiol., 2015, vol. 8, рр. 1-7.
    CrossRef
  22. Rubinson E., Galiakparov N., Radian S., Sela I., Tanne E., Gafny R. Serological detection of grapevine virus a using antiserum to a nonstructural protein, the putative movement protein. Phytopathology, 1997, vol. 87, рр.1041-1045.
    CrossRef

ЖҮЗІМНІҢ А ВИРУСЫ ГЕНОМЫН МОДИФИКАЦИЯЛАУ

 

Гриценко Д.А., Дерябина Н.Д., Галиакпаров Н.Н.
Өсімдіктердің биология және биотехнология институты,
Тимирязев к-сі, 45,
Алматы, 050040, Қазақстан
d
.kopytina@gmail.com

 

ТҮЙІН

Жүзімнің А вирусы (ВАВ) Vitivirus деген тегіне кіріп жатыр. Жүзімнің А вирусы жүзім қуыстылы сүрек деген құрама аурудың дамуында алғашқы рөл атқарады. Жүзімнің А вирустың геномы (7.4 мың н) 5 ашық оқу шеңберінен (ОРСтен) тұрады. 2 ОРСтың қызметі белгісіз.

Алма жапырақтарының хлоротикалық теңбілдігі вирусы  қабықша ақуызды кодтайтын тұқымын 2ОРС-ке клондау арқылы жүзімнің А вирусы тіреуінде векторды құрастыруға жұмыс жүргізілді. 2 ОРС арқылы жүзімнің А вирусы геномын модификациялау амплификация мен вирустың өсімдігіндегі қозғалысына ешқандай ықпал етпеуін көрсетті. Вирустың жұқтыру белгілері агроинфильтрациядан 6-8 күндерінде пайда болды. Қабықша ақуыздар агроинфильтрациядан 15 күнінде иммуноблоттинг арқылы инфильтратты жапырағында да, ең жоғарғы жапырағында да табылмай болды. Бұл мәселе 2ОРСтың әлсіз субгеномды промотормен байланыста болуы мүмкін. Бұлардан басқа, модификациялау жүзімнің А вирустың генетикалық тұрақтылығын гетерологиялы тұқымының кірісу арқылы дәлелденген.

Негізгі сөздер: жүзімнің А вирусы, ОРС2, қабықша ақуыз, қозғалыс ақуыз, алма жапырақтарының хлоротикалық теңбілдігі вирусы