4/2017
Rahimzhanova A.O., Kubash Zh.A., Ramankulov Y.M., Manabaeva Sh.A.
National Center for Biotechnology
Kоrgalzhyn road, 13/5, Astana, 010000, Kazakhstan
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

Genetic modification of cotton is given special attention due to its high economic value. The control of weeds that have a negative impact on its yield is one of the main problems in agriculture. As a result, the genetic engineering has become an unavoidable tool for reducing the negative impact of herbicides, causing significant damage to field crops. The aim of this work was to study the regeneration processes, and also to obtain herbicide resistant cotton plants by using Agrobacterium-mediated transformation. A recombinant construct pBPAT-GFP containing the genes phosphinothricin acetyltransferase PAT and GFP was created. The regeneration features of Kazakhstani varieties of cotton such as Mahtaaral-4005, Turkestan-1, Atakent-2010 in tissue culture were studied and incompetence to shoot formation was revealed, however, a single case of the formation of primordia from the callus was observed with the combination of hormones 2,4-D and zeatin in concentrations of 0,5 mg/l and 0.2 mg/l, as well as 2iP and NAA in concentrations of 5.0 mg/l and 0.1 mg/l. An effective method for regenerating shoots from stem apical meristems of transformed plants has been developed. Intensive shoot formation of two-day apical meristems of cotton with the content of two phytohormones with cytokine activity of BAP and kinetin at a concentration of 2.0 mg/l was revealed.

Keywords: cotton (G. hirsutum), growth regulators, regeneration, Agrobacterium-mediated transformation.


УДК 602.6:58; 632.9

ИЗУЧЕНИЕ РЕГЕНЕРАЦИОННОЙ И ТРАНСФОРМАЦИОННОЙ КОМПЕТЕНТНОСТИ СОРТОВ ХЛОПЧАТНИКА КАЗАХСТАНСКОЙ СЕЛЕКЦИИ

 

Рахимжанова А.О., Кубаш Ж.А., Раманкулов Е.М., Манабаева Ш.А.
Национальный центр биотехнологии
Кургальджинское шоссе, 13/5, Астана, 010000, Казахстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

АБСТРАКТ

Генетическим модификациям хлопчатника придается особое внимание вследствие его высокого экономического значения. Борьба с сорняками, оказывающими негативное влияние на урожайность, является одной из основных проблем сельского хозяйства. Таким образом, генная инженерия стала неизбежным инструментом для снижения негативного воздействия гербицидов, наносящих существенный ущерб данной культуре. Целью данной работы являлось изучение процессов регенерации, а также получение гербицидоустойчивых растений хлопчатника с помощью Agrobacterium-опосредованной трансформации. Для этого была создана рекомбинантная плазмида pBPAT-GFP, содержащая гены фосфинотрицинацетил трансферазы PAT и GFP. Изучены особенности регенерации казахстанских сортов хлопчатника Махтаарал-4005, Туркистан-1, Атакент-2010в культуре вегетативных органов и выявлена некомпетентность к побегообразованию, однако единичный случай образования примордия побега из каллусов был отмечен при комбинации гормонов 2,4-Д и зеатина в концентрациях 0,5 мг/л и 0,2 мг/л, а также 2iP и НУК в концентрациях 5,0 мг/л и 0,1 мг/л. Разработан эффективный способ регенерации побегов из стеблевых апикальных меристем трансформированных растений. Выявлено интенсивное побегообразование двухдневных апикальных меристем хлопчатника при содержании двух фитогормонов с цитокиновой активностью BAP и кинетин в концентрации 2,0 мг/л.

Ключевые слова: хлопчатник (G.hirsutum), регуляторы роста, регенерация, Agrobacterium-опосредованная трансформация.


ВВЕДЕНИЕ

Хлопча́тник (Gossypium), род семейства Мальвовые (Malvaceae), включает более 50 видов, культурные формы которого выращиваются в промышленных масштабах почти в шестидесяти пяти странах миракакпрядильные растения. Является источником растительных волокон– хлопка и играет важную роль в глобальной экономике. Для коммерческих целей в основном выращивают 4 вида: G.hirsutum, занимает более 90% всей посевной хлопковой площади, далее следует G.barbadens (египетский хлопок)–8% и остальные 2% –G.arborium и G.herbaceum, культивируемые главным образом на африканском и азиатском материках[1].

Хлопководство является одним из ведущих отраслей сельского хозяйства Республики Казахстан, а хлопок одна из немногих культур, урожай которых отправляется на экспорт. Южно-Казахстанская область была и остается основным регионом хлопководства республики. В 2016 году посевные площади хлопчатника в Южно-Казахстанской области составили около 109,6тыс. гектаров. Основными районами возделывания в ЮКО являются Мактааральский (70% валового сбора) и Шардаринский районы (15% валового сбора). В 2016 году в результате диверсификации посевных площадей хлопчатника в Мактааральском районе ЮКО возобновлена работа по развитию хлопководства. До 2020 года посевы хлопчатника планируются довести до 120 тыс. га и получить до 420 тыс. тонн хлопка-сырца (35 ц/га) [2].

На урожайность хлопчатника оказывают влияние множество как биотических, так и абиотических факторов. Одной из основных проблем является борьба с сорняками. Вред от сорных растений многообразен, что не только снижает, но и в ряде случаев приводит к гибели посевов. Широкое применение гербицидов в сельском хозяйстве для борьбы с сорной растительностью оказывает негативное воздействие и на сами растения, для защиты которых их используют. В связи с этим методы биотехнологии на основе генной инженерии для создания трансгенных растений, обладающих устойчивостью к этим химическим препаратам, имеют огромную актуальность, т.к.с помощью традиционной селекции вывести устойчивые сорта растений к наиболее широко используемым гербицидам невозможно.

Установлено, что признак гербицидоустойчивости является моногенным и это облегчает возможность использования технологии рекомбинантной ДНК для передачи этого признака. В настоящее время получены трансгенные растения, устойчивые к такому гербициду как глифосат (коммерческое название Раундап) [3]. Раундап был выведен на рынок компанией «Монсанто». Это самый продаваемый в мире гербицид[4], он активно используется и в странах СНГ. Получены трансгенные растения, устойчивые к хлорсульфуроновым и имидазолиноновым гербицидам [5, 6].

Изолированы также гены, которые кодируют ферменты деградации некоторых гербицидов, что позволило получать трансгенные растения, устойчивые к фосфинотрицину (глюфосинат аммония) [7], 2,4-Д[8], далапону [9], дикамбе [10] и т.д. Одним из наиболее широко применяемым гербицидом для борьбы с однолетними и многолетними сорняками является глюфоcинат аммония (фосфинотрицин, коммерческие названия –Баста, Либерти и Финал). В мире более 20 различных видов растений были трансформированы либо геном barиз S.hygroscopicus, либо геном patиз S.viridochromogenes,кодирующих фосфинотрицин-ацетилтрансферазу (РАТ)[11]. Фосфинотрицин, ингибитор глютаминсинтетазы, является активной составляющей глюфосината аммония [7, 12]. Глюфосинат аммония обладает контактным и локально-системным действием, усваивается зелеными частями растения и ингибирует активность фермента глутаминсинтетазы. Это приводит к накапливанию в клетке токсичного соединения –аммиака, вызывающего ее гибель. Растение, в которое введен этот ген, обладает способностью продуцировать фосфинотрицин-ацетилтрансферазу, который обеспечивает устойчивость растения к глюфосинату.

Таким образом, генетически измененные растения с устойчивостью к различным классам гербицидов в настоящее время остаются наиболее успешным биотехнологическим продуктом.

Среди способов генетической трансформации наиболее эффективным и надежным считается введение чужеродных генов с помощью Agrobacterium tumefaciens. Данный метод включает в себя два разных и одинаково важных этапа. Первый шаг влечет за собой передачу и стабильную интеграцию трансгена в геном растения. Второй этап включает восстановление трансгенного растения из стабильно трансформированной клетки. Для агробактериальной трансформации хлопчатника обычно используют семядоли и гипокотили [13], апикальные меристемы [14], поскольку выбор вегетативных органов в качестве эксплантов имеет решающее значение для успешного получения трансгенных растений [15].

 

МАТЕРИАЛЫ И МЕТОДЫ

Объектом исследований являлись сорта хлопчатника Махтаарал-4005,Туркистан-1, Атакент-2010 из коллекции Казахского научно-исследовательского института хлопководства.

Питательные среды. В качестве основной питательной среды на всех этапах культуры in vitro использовали минеральную основу МС, по прописи Мурасиге и Скуга (MС) [16], 30% сахарозы, 0,2% фитогеля.

Стерилизация семян. Для получения асептического растительного материала проводилось обеззараживание семян хлопчатника с применением стерилизующих агентов – 70% этанола и 10% раствора гипохлорита натрия. Ранее нами был отработан метод стерилизации семян хлопчатника сорта Туркистан[17]. Стерильные семена хлопчатника (3-4 семян в один бокс) высаживали в боксы маджента, содержащие 50 мл безгормональной среды МС, 30% сахарозы, 0,2% фитогель и проращивали в течение 2-14 дней.

Для агробактериальной трансформации эксплантов в виде гипокотилей и семядолей использовали экспланты из двухнедельных стерильных проростков. При трансформации апикальных меристем использовали экспланты из 2, 5 и 7-дневных стерильных проростков.

Регенерация. Регенерационный потенциал сортов хлопчатника Махтаарал-4005, Туркистан-1, Атакент-2010в культуре in vitro был изучен путем подбора оптимальных комбинаций ростовых регуляторов и типов эксплантов. Для инициации регенерации сегменты гипокотилей и семядолей культивировали на среде МС с добавлением разных регуляторов роста, в разных концентрациях: ИМК0,02 мг/л; Зеатин0,1-0,5 мг/л; Тидиазурон(ТДЗ) 1-2 мг/л; 2ip5,0 мг/л; Кинетин0,5-1,0 мг/л;БАП1 мг/л;НУК 0,02-0,1 мг/л;2,4-Д 0,1-0,5 мг/л.

Для индукции прямой регенерации применили подход, предложенныйYildiz M.[18]. Суть метода заключалась в высушивании эксплантов в стерильных условиях на воздухе 30 минут, затем вымачивании их в течение 15 минут в жидкой среде МСТН с содержанием гормонов ТДЗ и НУК, в концентрации 1 мг/л и 0,02 мг/л соответственно, с последующим их высаживании на твердую среду без гормонов или с содержанием гормонов. И в качестве контроля экспланты культивировались сразу на МС среду с содержанием гормонов 1 мг/л ТДЗ и 0,02 мг/л НУК без предварительной обработки. Всего было 3 варианта, из которых в варианте Iэкспланты высушивались, затем вымачивались и культивировалисьна среде без гормонов; во II варианте экспланты также высушивали и вымачивали, после высаживали на среду МС дополненные аналогичными гормонами в соответствующих концентрациях; в III варианте без предварительной обработки экспланты культивировали на среде МС, содержащей эти же гормоны.

Трансформация. В предыдущих работах нами были изучены и оптимизированы условия агробактериальной трансформации путем подбора параметров и штаммов Agrobacterium tumefaciens [19]. Поэтому для агробактериальной трансформации эксплантов использовали штамм A.tumefaciens октопинового типа LBA4404, ацетосирингон в концентрации 100 мкМ, при этом оптическая плотность суспензии бактерий составила 0,6 и время ко-культивации 48 часов.

Трансформированные гипокотильные и семядольные экспланты проходили селекцию на среде МС, содержащей 3фосфинотрицин (РРТ) для отбора эксплантов-трансформантов и 500 мг/л антибиотик цефотаксим для ингибирования роста агробактерий, тогда как 250 мг/л цефотаксима было достаточно для ингибирования роста агробактерий у трансформированных апикальных меристем. Фосфинотрицин является активным компонентом гербицида БАСТА, устойчивость к которому обеспечивается геном bar, который входит в состав конструкции pBPAT-GFP. Частоту каллусообразования еженедельно контролировали,  и каждые 10 дней пересаживали на свежую среду.

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Важной предпосылкой для создания трансгенного хлопчатника является детальное изучение проблемы введения его в культуру ткани. Стерилизация растительного материала является первым этапом для успешного культивирования растения в условиях in vitro. Следующим важным этапом является выбор вегетативных органов в качестве эксплантов. По мнению многих авторов, высокая степень пролиферации гипокотильных и семядольных сегментов хлопчатника позволяет использовать их в качестве эксплантов. В ряде работ показаны отличия эксплантовиз различных органов одного и того же растения по способности к морфогенезу в условиях in vitro [20, 21]. Также установлены различия по способности образовывать каллус на питательных средах при использовании разных регуляторов роста ауксинового и цитокининового типа, что определяется генотипом [22]. При этом доминирующую роль в регуляции процессов морфогенеза, помимо возраста, размера и других анатомических и функциональных особенностей экспланта, играют регуляторы роста.

Для индукции прямой регенерации изучаемых сортов хлопчатника в качестве регуляторов роста и развития на этапах введения в культуру в питательную среду вносили ауксин ИМК в концентрации 0,02 мг/л и цитокины в пяти вариантах и концентрации, как указано в таблице 1.

 

Таблица 1. Варианты питательной среды для индукции каллусогенеза в культуре in vitro
Table 1. Variants of a nutrient medium for induction of callusogenesis in vitro culture

Название/Вариант

Концентрация

ауксины

цитокинины

МСИЗ –I

 

ИМК–0,02 мг/л

Зеатин–0,5 мг/л            

МСИТ –II

Тидиазурон–2 мг/л

МСИП–III

2ip–5 мг/л

МСTK–IV

Тидиазурон–2 мг/л

Кинетин–1 мг/л

МСTB–V

Тидиазурон–2 мг/л

БАП–1 мг/л

Все три сорта Махтаарал-4005, Туркистан-1, Атакент-2010 на данных вариантах сред прямую регенерацию не дали, однако активный каллусогенез наблюдался практически у всех эксплантов. На рисунке 1 представлено формирование каллусной ткани у эксплантов хлопчатника в культуре in vitro через 3 недели культивирования. Каллусные клетки по структуре представляли собой несколько видов: плотные светло-зеленого цвета (рис. 1А); средней плотности (рис. 1Б) с хорошо выраженными меристематическими очагами; рыхлые, состоящие из сильно обводненных клеток, легко распадающиеся на отдельные агрегаты(рис. 1В) и имеющие нулевой морфогенный потенциал.

 
Рис. 1.Формирование каллусной ткани у эксплантов хлопчатника в культуре in vitro через 3 недели культивирования
Fig. 1.Callus formation in cotton explants in vitro culture after 3 weeks of cultivation

 

Эксперименты по индукции прямой регенерации, к сожалению, не увенчались успехом, и изучаемые нами отечественные сорта хлопчатника не дали ожидаемых результатов. Во всех случаях индуцировался каллусогенез, причем, как на средах с содержанием гормонов с предварительным высушиванием и вымачиванием, так и без предварительной обработки (таблица 2).

 

Таблица 2.Частота индукции каллусогенез агипокотильных эксплантов хлопчатника
Table 2.Callusogenesis frequency for hypocotyl explants of cotton

Варианты сред

Исходное количество

Частота каллусогенеза, %

I

МС

94

100

II

МСТН

55

100

III

МСТН

63

100

 Экспланты на среде МСТН с предварительной обработкой (II вариант) и без предварительной обработки (III вариант) через 2 недели набухли, а через месяц у них наблюдался массовый каллусогенез (рис. 2).

 
А – экспланты с предварительной обработкой (I вариант); Б – экспланты на среде МСТН (III вариант);В – массовый каллусогенез спустя месяц
Рис. 2. Индуцирование каллусной ткани у гипокотильных эксплантов хлопчатника
A - explants with preliminary treatment (variant I);  B - explants on MSTN medium (variant III), B - mass callusogenesis after one month
Fig. 2.Сallus induction in hypocotyl cotton explants

 

В другой серии экспериментов для изучения морфогенеза хлопчатника в культуре in vitro использовали питательную среду для соматического эмбриогенеза на основе среды Мурасиге и Скуга в сочетании экзогенных фитогормонов 2,4 Д и кинетина, в концентрации 0,1 мг/л и 0,5 мг/л соответственно. На данной среде экспланты на 8 сутки индуцировали каллусные ткани светло зеленого цвета с плотными очагами эмбриоидных структур белого цвета (рис. 3).

 
Рис. 3. Листовые экспланты, 7-дневные на среде МСДK
Fig. 3. Leaf explants, 7 days old on the medium MSDK

 

Экспланты с каллусами через 2 недели пересадили на среду с измененной концентрацией фитогормонов (таблица 3) для индукции эмбриоидогенеза.

 

Таблица 3. Частота индукции каллусогене засемядольных эксплантов хлопчатника
Table 3. Frequency of induction of callusogenesis of cotton cotyledon explant

Варианты гормонов (мг/л)

Количество эксплантов

Отзывчивость, %

варианты

2,4-D

кинетин

МSDK-I

0,01

3

145

100

МSDK-II

0,01

5

129

100

МSDK-III

-

5

100

10

 При дальнейшем культивировании на среде с первым и вторым вариантами наблюдается некоторая пролиферация эмбриогенного каллуса, характерной плотности белого и зеленого цвета, тогда как на среде МСДK III наблюдаетсянекроз у 90% эксплантов (рис.4).

 
Рис.4.Семядольные экспланты, на среде МСДK (I-III варианты)
Fig. 4. Cotyledon explants on a medium МСDK (I-III variants)

 

Индукция прямой регенерации побегов из семядольных и гипокотильных эксплантов, как из первичных эксплантов, так и из каллусныхструктур,в наших условиях не увенчалась успехом. Хотя однажды при комбинации гормонов 2,4-Д и зеатина в концентрациях 0,5 мг/л и 0,2 мг/л, а также при комбинации гормонов 2iP и НУК в концентрациях 5,0 мг/л и 0,1 мг/л удалось добиться образования примордия побега из каллусов, при этом через месяц после пассирования у него наступил некроз (рис. 5).

 
Рис. 5.Регенерация хлопчатника сорта Туркистан-1в культуре invitro
Fig. 5. Regeneration of cotton cultivar Turkestan-1in vitro culture

 

Среди способов генетической трансформации наиболее эффективным и надежным считается введение чужеродных генов с помощью A.tumefaciens. В качестве реципиентных систем для агробактериальной трансформации хлопчатника обычно используют вегетативные органы в качестве эксплантов – семядоли и гипокотили [13], апикальные меристемы [14]. Об успешной трансформации меристем растений хлопчатника сообщалась в работе Gould с соавт. [23]. Zapataс коллегами [14] использовали апексы побегов Техасского сорта хлопчатника CUBQHRPIS в качестве экспланта для агробактериальной трансформации. Показано, что трансформация апикальных меристем побегов позволяет избежать зависимости процесса регенерации от генотипа и решает проблему сомоклональной изменчивости.

Однако агробактериальная трансформация коммерческих сортов хлопчатника остается трудным и многоэтапным методом. При этом либо информация об эффективном протоколе трансформации ограничена, что не позволяет ее полностью воспроизвести, либо предлагаемая методика дает низкую частоту трансформации по причине зависимости морфогенеза хлопчатника от генотипа в культуре in vitro.

Трансформированные семядольные и гипокотильные экспланты хлопчатника были изучены на предмет каллусогенеза. Спустя два месяца провели подсчет фосфинотрицин устойчивых каллусов (таблица 4).

 

Таблица 4.Частота каллусообразования трансформированных эксплантов растений хлопчатника в культуре in vitro
Table 4.The callus formation frequency of transformed cotton explants in vitro culture

Штамм

Фосфинотрицин устойчивые каллусы через два месяца после трансформации

LBA4404

Туркистан-1

Махтаарал-4005

Атакент 2010

семядоли

гипокотили

семядоли

гипокотили

семядоли

гипокотили

1,1±0,1

1,3±0,1

2,5±0,3

2,1±0,2

2,8±0,2

2,5+0,2

n=125

n=156

n=338

n=76

n=245

n=90

25%

15%

52%

31%

72%

68%

Примечание

1 – n – количество семядольных и гипокотильных эксплантов;

2 – в % выражено количество эксплантов, индуцировавших хотя бы один каллус.

Максимальная частота каллусообразования (68-72%) была отмечена у трансформированных семядольных и гипокотильных эксплантов сорта Атакент-2010. Следует отметить, что общий уровень каллусообразования при культивировании трансформированных гипокотильных эксплантов был ниже. Низкие показатели частоты каллусообразования выявлены у эксплантов сорта Туркистан-1. В экспериментах была использована селективная среда МС с комбинацией гормонов 2,4-Д и зеатина, в концентрациях 0,5 мг/л и 0,1 мг/л соответственно, которая оказалась наиболее оптимальной для длительного субкультивирования каллусов (рис. 6).

 
Рис. 6. Формирование каллусной ткани у трансформированных гипокотильных (а) и семядольных (б) эксплантов хлопчатника в культуре invitro
Fig. 6. The callus formation of transformed cotton hypocotyl (a) and cotyledonous (b) explants in vitro culture 

 

Мониторинг экспрессии гена GFP в системе транзиентной экспрессии показал (рис. 7), что наибольшая частота транзиентной экспрессии гена GFP достигается при продолжительности инокуляции эксплантов с агробактерией в течение 30 минут и при концентрации ацетосирингона 100 µM.

 
а – трансформированные каллусы; б – нетрансформированные каллусы
Рис. 7.GFPэкспрессия в каллусной культуре
a – transformed calli; b – non-transformed calli
Fig. 7. GFP expression in callus culture

 

Агробактериальная трансформация с использованием побеговых апикальных меристем [24] и пыльцы [25] позволяет избежать проблему зависимости регенерации от генотипа, занимает мало времени и решает проблему сомаклональной изменчивости. В связи с этим, при введении в хлопчатник гена гербицидоустойчивости в качестве реципиентных систем нами также были изучены апикальные меристемы побегов.

Для инициации роста апикальных меристем хлопчатника в условиях in vitro использовались несколько вариантов питательных сред с добавлением фитогормонов в различных концентрациях (таблица 5), при этом учитывали количество побегов на одну апикальную меристему.

 

Таблица 5. Частота побегообразования трансформированных апикальных меристем
Table 5. Frequency of shoot formation of transformed apical meristems

Тип экспланта

Комбинация и концентрация

фитогормонов

Количество побегообразований

 

Апикальные меристемы

BAP– 0,5 мг/л

Кинетин– 0,5 мг/л

1

BAP– 1,0 мг/л

Кинетин– 1,0 мг/л

1

BAP– 2,0 мг/л

Кинетин–2,0 мг/л

4-5

Повышенное содержание двух фитогормонов с цитокиновой активностью привел к интенсивному побегообразованию у двухдневных апикальных меристем хлопчатника через 3-4 недели культивирования на среде МС, содержащей витамины ГамборгаВ5, гормоны кинетин и БАП в концентрации 2 мг/л (рис.8).

 
Рис. 8.Интенсивное побегообразование апикальных меристем хлопчатника
Fig. 8.Intensive shoot formation of the cotton apical meristems

 

С целью избавления от продуктов окисления фенолов выделяемыми эксплантами в питательных средахсахарозу заменяли после первого пассажа глюкозой и переносили эксплантына свежую среду каждые 10 дней, в качестве антиоксиданта также в питательную среду добавляли ПВП (1 г/л), который уменьшал фенольное окисление и способствовал регенерации побегов хлопчатника. Всего было трансформировано 152 апикальные меристемы. 

Трансформированные апикальные меристемы культивировали при оптимальных для регенерации условиях (рис. 9).

 
Рис. 9.Трансформированные апикальные меристемы хлопчатника в культуре in vitro
Fig. 9. Transformed cotton apical meristems in vitro culture 

 

Побеги культивировали в течение месяца при температуре 28±2оС и 16-часовом фотопериоде. Отбор побегов, регенерировавших и выживших на среде с антибиотиком и селективным агентом РРТ, провели через месяц после ко-культивации.

Таким образом, в результате изучения эффективности получения растений-регенерантов из трансформированных апикальных меристем сортов хлопчатника в культуре in vitro были получены укорененные, фосфинитрицин устойчивые растения-регенеранты из трансформированных апикальных меристем хлопчатника сортов Махтаарал-4005 и Туркистан-1 (рисунок 10).

 
Рис.10. Растения-регенеранты из трансформированных апикальных меристем хлопчатника
Fig. 10. Plants regenerated from transformed cotton apical meristems

 

Молекулярный анализ растений-трансформантов проводился с помощью ПЦР на наличие чужеродных генов, используя кДНК, полученные из геномной РНК трансформированных растений-регенерантов. Профиль геномной РНК растений-трансформантов приведен на рисунке 11.

 
М – ДНК маркер; 1-14 – РНК растений-трансформантов
Рис. 11. Оценка количества и качества РНК при помощи электрофореза в 1% агарозном геле
M–DNA marker; 1-14 – RNA of plant transformants
Fig. 11.Evaluation of the quantity and quality of RNA by gel electrophoresis

 

кДНК растений-трансформантов подвергли мультиплексному ПЦР мониторингу на наличие геновPAT(443п.н.) и GFP (744 п.н.), часть из которых показана на рисунке 12.При мультиплексном ПЦР в одной и той же реакционной среде происходит процесс коамплификации нескольких ДНК-овых матриц с участием нескольких пар праймеров. Интеграцию гена PAT в геном хлопчатника проверили с помощью следующих праймеров: прямойPAT: 5’-GTCTGCACCATCGTCAACC-3’и обратный PAT: 5’-GAAGTCCAGCTGCCAGAAAC-3’. Последовательность гена GFP была амплифицирована с помощью праймеров: F: 5`gcatgcccaccttcgagatcg 3’` и R: 5`gcttgcatgcctctagactgcagtt 3’.Синтез проводили в следующем температурном режиме:

 

+94°C                    10мин

 

+94°C                    30сек

}25 циклов

+58°C                    45 сек

+72°C                    1 мин

+72°C                    10 мин

 

+4°C                      2 мин

 

 

Продукты ПЦР анализировались в 1% агарозном геле (рис.12).

 
М – ДНК маркер; +PAT, +GFP – позитивные контроли; 1-6 –кДНК растений-трансформантов
Рис. 12.Электрофорез ПЦР-продуктов, амплифицированных с праймерами, специфичными к генам РАТ и GFP в 1% агарозном геле
M – DNA marker; + PAT, +GFP – positive controls; 1-6 – cDNA of plant transformants
Fig. 12. Electrophoresis of PCR products amplified with primers specific for PAT and GFP genes in a 1% agarose gel

 

Как видно из результатов разделения продуктов амплификации, представленных на электрофореграмме (рис. 12), наличие амплифицированных фрагментов длиной 744 пар и443 пар нуклеотидов совпадают по размеру с ПЦР-фрагментом плазмиды, что свидетельствует об интеграции гена GFP и РАТ в ядерный геном растений хлопчатника. Для исключения ложнопозитивных результатов полученные растения-трансформанты также были проверены на наличие бактериальных virD2 генов и получены результаты, подтверждающие чистоту трансформантов от загрязнения A.tumefaciens.

В результате вышеизложенного исследования были получены укорененные, фосфинотрицин устойчивые растения-регенеранты из трансформированных апикальных меристем хлопчатника сортовМахтаарал-4005, Туркистан-1 и Атакент-2010.

 

ВЫВОДЫ

В результате проделанной работы были изучены особенности каллусогенеза и морфогенеза сортов хлопчатника казахстанской селекции в культуре вегетативных органов на модифицированной питательной среде МС. Установлено iP и НУК в концентрациях 5,0 мг/л и 0,1 мг/л. Штамм LBA4404 выбран для проведения экспериментов по агробактериальной трансформации эксплантов. Установлено, что для Agrobacterium-опосредованной трансформации ацетосирингон в концентрации 100 мкМ, суспензия бактерий при О.П.=0,6 и 48-часовая ко-культивация с бактерией являются оптимальными. При этом были выявлены отличия казахстанских сортов хлопчатника по способности каллусов к образованию морфогенных зон клеток, также установлена неспособность эмбриогенных структур индуцировать полноценные регенеранты. В результате мониторинга с помощью универсального инвертированного микроскопа AxioObserver A1 пролиферирующих каллусов на селективной среде подтверждена стабильная экспрессия GFPв транформированных клетках.

Разработан эффективный способ регенерации побегов из стеблевых апикальных меристем трансформированных растений. Интенсивное побегообразование обнаружено у двухдневных апикальных меристем на среде МС, содержащей витамины Гамборга В5 и фитогормоны – кинетин/БАП в концентрации 2 мг/л. В результате ступенчатой селекции получены укорененные, фосфинотрицин устойчивые растения-регенеранты из культуры апексов хлопчатника сортов Туркистан-1 и Махтаарал-4005. Мониторинг фосфинотрицин устойчивых 46 растений хлопчатника сорта Туркистан-1и Махтаарал-4005 проведен с помощью ПЦР на наличие целевых генов, подтвержден трансгенный статус и экспрессия гетерологичного гена в 11 из них.

 

Финансирование

Исследования выполнены при поддержке Министерства образования и науки РК по проекту «Разработка биотехнологии создания трансгенных растений хлопчатника с устойчивостью к гербицидам сплошного действия», в рамках реализации НТП О.0677 «Разработка биотехнологических основ создания и мониторинга генетически модифицированных растений с улучшенными хозяйственно-ценными признаками» на 2015-2017 гг.

 

REFERENCES

 

  1. Juturu V.N., Mekala G.K., Kirti P.B. Current status of tissue culture and genetic transformation research in cotton (Gossypium spp.).Plant Cell, Tissue and Organ Culture (PCTOC), 2014, vol. 120, no. 3,pp. 813-839.
  2. V Yuzhnom Kazakstane namereny sobrat 295 tys. tonn hlopka-syrca// // http://kazakh-zerno.kz/.2016.
  3. Gianessi L.P. Economic impacts of glyphosate-resistant crops.Pest Manag Sci., 2008, vol. 64, no. 4, pp. 346-352.
  4. Global Status of Commercialized Biotech.GM Crops., 2007.
  5. Li Z. H.A., Murai N. A sulfonyurea herbicide resistant gene from Arabidopsis thaliana as a new selective marker for production of fertile transgenic rice plant.Plant Physiology, 1992, vol. 100,pp. 662-668.
  6. Tan S., Evans R.R., Dahmer M.L., Singh B.K., Shaner D.L. Imidazolinone-tolerant crops: history, current status and future.Pest Manag Sci., 2005, vol. 61, no. 3,pp. 246-257.
  7. Herouet C., Esdaile D.J., Mallyon B.A., Debruyne E., Schulz A., Currier T., Hendrickx K., van der Klis R.J., Rouan D. Safety evaluation of the phosphinothricin acetyltransferase proteins encoded by the pat and bar sequences that confer tolerance to glufosinate-ammonium herbicide in transgenic plants.Regul Toxicol Pharmacol, 2005,vol. 41, no. 2,pp.134-149.
  8. Charles G.W., Constable G.A., Llewellyn D.J., Hickman M.A. Tolerance of cotton expressing a 2,4-D detoxification gene to 2,4-D applied in the field.Australian Journal of Agricultural Research, 2007,vol.58, no. 8,pp.780.
  9. Buchanan W.V. N.A., Cannon F.C. A plant selectable marker gene based on the detoxification of the herbicide dalapon.Plant Cell Reports, 1992,vol. 11, pp. 627-631.
  10. Behrens M.R., Mutlu N., Chakraborty S., Dumitru R., Jiang W.Z., Lavallee B.J., Herman P.L., Clemente T.E., Weeks D.P. Dicamba resistance: enlarging and preserving biotechnology-based weed management strategies.Science, 2007,vol. 316, no.5828,pp. 1185-1188.
  11. Vasil I.K. Phosphinothricin-resistant crops Herbicide-Resistant Crops: Agricultural, Environmental, Economic, Regulatory, and Technical Aspects / Duke O.: Boca Raton, 1996. Herbicide-Resistant Crops: Agricultural, Environmental, Economic, Regulatory, and Technical Aspects,pp. 85-91.
  12. Ozyigit I.I. K.M.V., Ercan O. Relation between Explant Age, Total Phenols and Regeneration Response in Tissue Cultured Cotton (Gossypium hirsutum L.).African Journal of Biotechnology, 2007,vol. 6,pp. 3-8.
  13. Sunilkumar G., Rathore K.S. Transgenic cotton: factors influencing Agrobacterium-mediated transformation and regeneration.Molecular Breeding, 2001,vol. 8, no. 1, pp. 37-52.
  14. Zapata C., Park S.H., El-Zik K.M., Smith R.H. Transformation of a Texas cotton cultivar by using Agrobacterium and the shoot apex.Theoretical and Applied Genetics, 1999,vol. 98, no. 2, pp. 252-256.
  15. Rathore K.S., Sunilkumar G., Campbell L.M. Cotton (Gossypium hirsutum L.).Methods Mol Biol., 2006,vol. 343,pp. 267-279.
  16. A revised medium for rapid growth and biosynthesis with tobacco tissue culture Plant Physiology / Murashige T.S.F., 1962,pp. 473-497.
  17. Manabayeva S.A., Rakhimzhanova A.O., Kairzhanova A.D., Ramankulov Е.M. Izucheniye kallusogeneza i morfogeneza hlopchatnika sorta «Turkistan» v kul'ture in vitro. Eurasian Journal of Applied Biotechnology, 2013, no. 4, str. 68-73.
  18. Manabayeva S.A., RakhimzhanovaA.O. Optimizatsiya usloviy Agrobacterium-oposredovannoy transformatsii hlopchatnikа. Vestnik KazNU, Seriya biologicheskaya, 2013, vol. 4, s. 200-203.
  19. Butenko R.G. Biologiya kul'tiviruyemykh kletok i biotekhnologiya na ikh osnove. M.: FGK-PRESS, 1999, s. 160.
  20. Golovkin B.N., Rudenskaya R.N., Trofimov I.A. Biologicheski aktivnye soyedineniya rastitel'nogo proiskhozhdeniya. M., 2002, s. 105-223.
  21. Bykova E.V., Lev S.V. Genotipicheskiye osobennosti protsessa kallusogeneza u hlopchatnika.Genetika, 1988, vol.24, no. 7, str. 1317-1370.
  22. Yildiz M. The Prerequisite of the Successin Plant Tissue  Culture: High Frequency Shoot Regeneration. 2012.10.5772/51097.
  23. Gould J.H., Magallanes-Cedeno M. Adaptation of cotton shoot apex culture to Agrobacterium-mediated transformation.Plant molecular biology reporter, 1998,vol. 16,pp. 283-283.
  24. Rashid H., Yokoi S., Toriyama K., Hinata K. Trans-genic plant production mediated by Agrobacterium in Indica rice. Plant Cell Reports, 1996, vol. 15,pp. 727-730.
  25. Bishimbayeva N., Ertayeva B., Amirova A., Guseinov I.R., Umbetayev I., Rakhimbayev I. Approaches to the elaboration of regeneration and transformation systems for elite Kazakh cotton varieties // Abstracts of the International Cotton Genome Initiative Research Conference. Anyang China, 2008, pp. 51.

 

ҚАЗАҚСТАН СЕЛЕКЦИЯСЫ МАҚТА СОРТТАРЫНЫҢ РЕГЕНЕРАЦИЯЛЫҚ ЖӘНЕ ТРАНСФОРМАЦИЯЛЫҚ ҚАБІЛЕТТІЛІГІН ЗЕРТТЕУ

Рахымжанова А.О., Құбаш Ж.А., Раманқұлов Е.М., Манабаева Ш.А.
Ұлттық биотехнология орталығы
Қорғалжын тас жолы, 13/5, Астана, 010000, Қазақстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Генетикалық түрлендірілген мақтаның жоғары экономикалық маңызына байланысты ерекше назар аударылады. Ауыл шаруашылығы негізгі мәселелерінің бірі оның өнімділігіне кері әсер ететін арамшөптермен күресу болып табылады. Осылайша, мақта өсімдігіне айтарлықтай залал келтіретін гербицидтердің теріс әсерін азайтуда гендік инженерия бұлжымас құрал болып табылады. Бұл жұмыстың мақсаты мақтаның регенерация үрдісін зерттеу және Agrobacterium-жанамалы трансформация арқылы гербицидке төзімді мақта өсімдігін алу болып табылады. ол үшін фосфинотрицин ацетилтрансфераза PAT және GFP гендері бар рекомбинантты плазмида жасалды. Қазақстандық мақта сорттары Мақтаарал-4005, Түркістан-1, Атакент-2010 вегетативті мүшелер культурасында регенерациялық қабілеттілігі зерттелді және өркен пайда болу қабілетінің біліксіздігі анықталды, алайда, гормондардың комбинациясы 2,4-Д және зеатин 0,5 мг/л және 0,2 мг/л концентрациясында, сондай-ақ 2iP және НУК 5,0 мг/л-0,1 мг/л концентрациясында болған жағдайда каллустан өркен ұшы байқалды. Трансформацияланған өсімдіктерді сабақтық апикалды меристемадан регенерациялаудың тиімді тәсілдері жасалды. Цитокинді белсенділікті екі фитогормондар БАП және кинетин 2,0 мг/л концентрациясында мақтаның екі күндік апикалды меристемасында қарқынды өркен түзілуі анықталды.

Негізгі сөздер: Мақта (G. hirsutum), өсу реттегіштер, регенерация, Agrobacterium-жанамалы трансформация.