4/2015

 

УДК 577.21; 602.3:579.8; 664:502.171; 664:658.587

 

ПОЛУЧЕНИЕ РЕКОМБИНАНТНОЙ Α-АМИЛАЗЫ AMY1UA7 ИЗ BACILLUS SUBTILIS В КЛЕТКАХ ESCHERICHIA COLI

Калимкулова М., Кирибаева А., Мухамедьяров Д., Куламетов Ж., Ахметоллаев И., Силаев Д., Хасенов Б.
Национальный центр биотехнологии
Кургальжинское шоссе, 13/5, Астана, 010000, Казахстан
asel_
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

АБСТРАКТ

Ферменты, осуществляющие гидролиз крахмалосодержащего сырья, широко используются в современной биотехнологической промышленности. В представленной работе для изучения биохимических параметров a-амилаза Amy1UA7 из Bacillus subtilis была получена в рекомбинантной форме в клетках Escherichia coli. Ген аmy1UA7 был синтезирован из олигонуклеотидов и клонирован в составе вектора рЕТ-28с(+) под контролем промотора бактериофага Т7. Путем плазмидной экспрессии гена в клетках штамма BL21(DE3) получен рекомбинантный белок Amy1UA7, очистка которого проводилась методами металлоаффинной хроматографии. В ходе изучения был установлен температурный и кислотный оптимум рекомбинантного фермента, определено влияние ионов металлов и органических кислот на ферментативную активность. Изучение влияния температуры на активность a-амилазы Amy1UA7 показало, что эффективность гидролиза крахмала рекомбинантной α-амилазы Amy1UA7 увеличивается с ростом температуры до +50°С…+55°С, при которой амилазная активность имеет максимальное значение 165 U. Установлено, что α-амилаза Amy1UA7 активна в широком диапазоне рН (от 4 до 9), сохраняя при этом более 80% от максимального значения активности. Выявлено, что α-амилаза Amy1UA7 является кальций независимым ферментом, обладающим толерантностью к ряду ионов металлов и органических кислот.

Полученные данные являются существенными для применения рекомбинантного фермента в биотехнологических процессах при гидролизе полисахаридов.

Ключевые слова: a-амилаза, Bacillus, рекомбинантый фермент, амилазная активность.

 

GENERATION OF A RECOMBINANT Α-AMYLASE, AMY1UA7, FROM BACILLUS SUBTILIS IN ESCHERICHIA COLI

 

Kalimkulova M., Kiribayeva A., Mukhamedyarov D., Kulametov Zh., Akhmetollayev I., Silayev D., Khassenov B.
National Center for Biotechnology
13/5, Korgalzhyn Road, Astana, 010000, Kazakhstan
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

Enzymes that mediate hydrolysis of starch-containing raw materials are widely used in the modern biotechnology industry. In the present study, a recombinant α-amylase, Amy1UA7, from Bacillus subtilis was generated in Escherichia coli, in order to study its biochemical parameters. The Amy1UA7 gene was synthesized by oligonucleotides and cloned in a pET-28c (+) vector under the control of the bacteriophage T7 promoter. Recombinant Amy1UA7 was obtained in BL21 (DE3) cells by plasmid gene expression; protein purification was carried out by metal affinity chromatography. During the study, the temperature and acid optimum of the recombinant enzyme was fixed, and the impact of metal ions and organic acids on enzymatic activity was determined. Analysis of the effect of temperature on the activity of Amy1UA7 demonstrated that the efficiency of starch hydrolysis by the recombinant α-amylase increased up to + 50°C to + 55°C, when amylase activity had a maximum value of 165 U. The results also demonstrated that amylase α-Amy1UA7 remains active in a wide pH range (4–9) while retaining more than 80% of its maximum activity. In addition, it is a calcium-independent enzyme that has tolerance to a range of metal ions and organic acids.

These data are essential for encouraging the use of recombinant enzymes in biotechnological processes involving the hydrolysis of polysaccharides.

Keywords: α-amylase, Bacillus, recombinant enzymes, amylase activity.


 

ВВЕДЕНИЕ

Одним из наиболее известных ферментов, используемых в пищевой биотехнологии, является амилаза [1].Амила́за – фермент, гликозил-гидролаза, расщепляющий крахмал до олигосахаридов: декстринов, мальтозы и глюкозы. По субстратной специфичности амилазы классифицируют на три типа амилаз, обозначаемых a, β и γ и расщепляющих α-1,4-гликозидные связи в полимерах крахмала с сохранением α-аномерной конфигурации в образующихся молекулах мальтозы и декстринов [2]. Αльфа-амилаза (КФ 3.2.1.1; 1,4-α-D-глюкан-глюканогидролаза; гликогеназа) является эндоферментом, способным гидролизовать полисахаридную цепь крахмала и других длинноцепочечных углеводов в любом месте, ускоряя,таким образом, процесс гидролиза, что приводит к образованию олигосахаридов различной длины[3].

Ферменты с α-амилазной активностью обнаружены во многих организмах [4]. У животных α-амилаза является основным пищеварительным ферментом,гидролизующим крахмал. Данный фермент обнаружен также у растений, в грибах и бактериях. Для промышленных нужд чаще всего используются бактериальные α-амилазы, продуцируемые бактериями рода Bacillus, а также α-амилазы из грибов рода Aspergillus. Синтезируемые бактериями рода Bacillusα-амилазы имеют ряд ценных в биотехнологии характеристик: повышенную термостабильность, толерантность к присутствию в субстрате органических соединений, активность в широком диапазоне рН [4,5]. Известно, что большинство ферментов начинает денатурировать и терять свою активность при температурах выше 50-60 градусов Цельсия, но термостабильные a-амилазыобеспечивают нормальный ход каталитической реакции при данных температурах [6].

На данный момент ряд штаммов рода Bacillus:B. subtilis, B. licheniformis и B. amyloliquefaciens используются в роли коммерческих продуцентов термостабильных a-амилаз [7]. Интерес к a-амилазам бактериального происхождения вызван ввиду их гетерогенности и большого разнообразия, а также широким спектром производственного применения, что подтверждается как наличием кальций зависимых амилаз с оптимумом в слабокислой среде, так и кальций независимыми амилазами с оптимумом в щелочной среде [8,9].

На основе исследования первичных структур большого числа α-амилаз и родственных им ферментов из разных организмов были обнаружены общие для амилолитических ферментов особенности. В структуре α–амилаз представлены три домена. Каталитический домен A формирует (β/α) 8-цилиндрическую структуру (TIM-цилиндр) и имеет две крупные петли, образующие домены B и C, которые богаты β-слоями и участвуют в распознавании и укладке субстрата. Все известные α-амилазы содержат в структуре один или несколько ионов кальция, принимающих участие в поддержании активности и стабильности фермента [10]. Не останавливаясь на нативных амилазах, исследователи проводят работы по структурной оптимизации ферментов для достижения лучших потребительских свойств при использовании в промышленной биотехнологии [5,11].

Целью настоящей работы является получение и определение биохимическихпараметров рекомбинантной бактериальной a-амилазы для использования в пищевой и перерабатывающей промышленности.

 

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

В работе были использованыбактериальные штаммы EscherichiacoliDH5α, BL21(DE3), ArcticExpress(DE3)RP, Rosetta2 (DE3). Штамм DH5α использовали в создании экспрессионных векторов при отборе лигированныхплазмид,BL21(DE3),ArcticExpress(DE3), Rosetta2(DE3) в качестве хозяйского штамма при создании рекомбинантного штамма-продуцента. Были использованы вектораpGEM-T (Promega),рЕТ-28с(+) (Novagen) в качестве клонирующего и экспрессионного векторов соответственно.

В работе использовался низкосолевой бульон Луриа-Бертани(1% триптона, 0,5% дрожжевого экстракта, 0,5% NaCl). Для культивирования клеток Escherichiacoli после трансформации использовалась среда SOC (2% триптона, 0,5% дрожжевого экстракта, 0,05% NaCl, 2,5 мМKCl, 20 мМMgSO4, 20мМ глюкозы, pH7,5). Приготовление всех сред осуществлялось в соответствии с протоколами Маниатиса[12].

 

Синтез гена альфа-амилазы Amy1UA7

На основе биоинформационного анализас использованием базы данных Brendaнаиболее эффективным по ряду параметров был выбран вариант α-амилазы 1UA7, полученный из микроорганизма Bacillussubtilis. Определение аминокислотной и нуклеотидной последовательности a-амилазы проводили на основе данных, представленных в ProteinDataBank. Структурно a-амилаза 1UA7 состоит из 422 аминокислотных остатков и имеет молекулярный вес равный 47,8 кДа.

В таблице 1 представлены последовательности олигомерных праймеров, разработанных для проведения синтеза гена α-амилазы denovo.

Были использованы следующие олигонуклеотиды, синтезированные фосфоамидитным способом на синтезаторе ASM800 (Россия)и очищенные в ПААГ (таблица 1).

 

Таблица1. Олигонуклеотиды
Table 1. Oligonucleotides

Наименование

 

Name

Нуклеотидная последовательность в направлении 5’-3’

 

Sequence in the 5'-3 '

1

2

Amylase-01

 

ATGTTTGCAAAACGATTCAAAACCTCTTTACTGCCGTTATTCGCTGGATTTTTATTGCTGTTTTATTTGGTTCTGGCAGGACCGGCGGCTGCGAGTGCTG

Amylase-02

ATTGAACGACCAATTCCATGCATGAAGAATGGTTCCGCTTTTGATCGACGGTGCTGTAAGCTCATTCGATTTGTTCGCCGTTTCAGCACTCGCAGCCGCC

Amylase-03

ATGCATGGAATTGGTCGTTCAATACGTTAAAACACAATATGAAGGATATTCATGATGCAGGATATACAGCCATTCAGACATCTCCGATTAACCAAGTAAA

Amylase-04

TTGCCAATTTGATACGATGTCGGCTGATACAGCCAGTACCAGTTCGACATGCTTTTATCTCCTTGATTCCCTTCCTTTACTTGGTTAATCGGAGATGTCT

Amylase-05

CCGACATCGTATCAAATTGGCAACCGTTACTTAGGTACTGAACAAGAATTTAAAGAAATGTGTGCAGCCGCTGAAGAATATGGCATAAAGGTCATTGTTG

Amylase-06

GTGTCCAGTTTGGAATACTCTTAACCTCATTCGAAATCGCGGCATAATCACTGGTGGTATGATTGATGACCGCGTCAACAATGACCTTTATGCCATATTC

Amylase-07

GTTAAGAGTATTCCAAACTGGACACATGGAAACACACAAATTAAAAACTGGTCTGATCGATGGGATGTCACGCAGAACTCATTGCTCGGGCTGTATGACT

Amylase-08

AAAACCGTCTGCCCCGTCATTCAATGCCCTTTCTAAGAACCGTTTCAGATAGGACTGTACTTGTGTATTTTGTGTATTCCAGTCATACAGCCCGAGCAAT

Amylase-09

GACGGGGCAGACGGTTTTCGATTTGATGCAGCCAAACATATAGAGCTTCCGGATGATGGGAGTTACGGCAGTCAATTTTGGCCGAATATCACAAATACAT

Amylase-10

ACATCCATATAATTCGCGTATGCAGCATCTCTGGAGGCACTATCCTGCAGGATTTCTCCGTATTGGAACTCTGCAGATGTATTTGTGATATTCGGCCAAA

Amylase-11

GCATACGCGAATTATATGGATGTGACAGCGTCTAACTATGGGCATTCCATAAGGTCCGCTTTAAAGAATCGTAATCTGGGCGTGTCGAATATCTCCCACT

Amylase-12

GACTCTTCATCATCATTGGCATACGTATCATGCGACTCCACCCATGTCACCAGCTTGTCCGCAGACACATCAGATGCATAGTGGGAGATATTCGACACGC

Amylase-13

GTATGCCAATGATGATGAAGAGTCGACATGGATGAGCGATGATGATATCCGTTTAGGCTGGGCGGTGATAGCTTCTCGTTCAGGCAGTACGCCTCTTTTC

Amylase-14

AATAAAGCACTCCCGCGATCGCCTATTTGGCTTTTCCCCGGGAATCTCACACCATTTCCGCCTCCCTCAGGTCTGGAAAAGAAAAGAGGCGTACTGCCTG

Amylase-15

GATCGCGGGAGTGCTTTATTTGAAGATCAGGCTATCACTGCGGTCAATAGATTTCACAATGTGATGGCTGGACAGCATGAGGAACTCTCGAACCCGAATG

Amylase-16

GATAGAGACAGAGGATGAACCTGCATTTGCCAGCACAACGCCATGTGAGCCGCGCTGATTCATAAATATCTGGTTGTTTCCATTCGGGTTCGAGAGTTCC

Amylase-17

CAGGTTCATCCTCTGTCTCTATCAATACGGCAACCAAATTGCCTGATGGCAGGTATGACAATAAAGCTGGAGCGGGTTCATTTCAAGTGAACGATGGTAA

Amylase-18

TTGAAAGAATGTGTTACACCTGATTTCAATATCATCAGGATAAAGCACAGCTACAGACCTGGCATTGATCGTGCCTGTCAGTTTACCATCGTTCACTTGAAATGAA

flanc_F

ATGTTTGCAAAACGATTCAAAACCT

flanc_R

TTGAAAGAATGTGTTACACCTGATTTCA

intF

TTGGCCGAATATCACAAATACAT

intR

ATGTATTTGTGATATTCGGCCAA

NdeIAmy1UA7fw

GGGAATTCCATATGTTTGCAAAACGATTCAAAACC

BamHIAmy1UA7rv

CGCGGATCCGTTATTGAAAGAATGTGTTACACCTG

XhoIAmy1UA7rv

CCGCTCGAGTTGAAAGAATGTGTTACACCTG

M13fw

GTAAAACGACGGCCAG

M13rv

CAGGAAACAGCTATGAC

T7fw

TAATACGACTCACTATAGGG

T7rv      

GCTAGTTATTGCTCAGCGG

Сборку гена из олигомеров осуществляли с помощью Pfu ДНК полимеразы в несколько этапов.Первым этапом была сборка промежуточной конструкции гена с размерами: 724 и 736 пар оснований. Олигомеры Amylase01-09 и Amylase10-18 смешивали с 200 мMdNTP и проводили ПЦР. Условия ПЦР:25 циклов +94°C - 30 сек; +55°C - 2 мин; +72°C - 90 сек. Далееиспользовали 25мкл ПЦР смеси, добавляли 200 мMdNTP и ставили ПЦР с использованием фланкирующихпраймеровflankF/intR и intF/flankRв количестве 10 мкмоль. Условия ПЦР были идентичными предыдущему шагу. Вторым этапом была сборка гена с размером 1434 пар оснований. Использовалась парафланкирующихпраймеровflancF/flankR. Полученный ПЦР-продукт был клонирован в составе высококопийнойплазмидыpGEM-T. Соответствие нуклеотидной последовательности подтверждали секвенированием с использованием набора BigDye 3.1 и автоматического секвенатора ABIPrism3100 (AppliedBiosystems, США).Анализ хроматограмм и сличение их с заданной последовательностью проводилось с использованием пакета программVectorNTI версии 11.

 

Клонирование гена Amy1UA7в составе экспрессирующего вектора рЕТ-28с(+)

При клонировании были использованы две стратегии: в первом случае клонирование целевого гена проводили таким образом, чтобы в одной конструкции гексагистидиновая метка была присоединена к N-концу белка Amy1UA7, во втором случае–результирующий белок содержал дополнительную гексагистидиновую метку с С-конца. Клонирование осуществлялось с использованием ферментов нуклеинового обмена по рестрикционным сайтам NdeI/Xho. Использовались протоколы по клонированию, описанные в предыдущих статьях [13-16], с использованием двух пар праймеровNdeIAmy1UA7fw/BamHIAmy1UA7rv и NdeIAmy1UA7fw/XhoIAmy1UA7rvдля получения 6His-Amy1UA7и 6His-Amy1UA7-6Hisконструкций соответственно.Гидролиз плазмидной ДНК, дефосфолилирование и лигированиеосуществлялось с использованием ферментовNdeI, XhoI, BamHI, FastAP, T4 DNAligase и соответствующих буферов к ним: BufferOrange и T4 DNALigaseBuffer производства ThermoScentific. Правильность сборки конструкции подтверждали секвенированием нуклеотидной последовательностис использованием концевыхпраймеровT7fw/T7rv и внутренних праймеров: intF/intR, flankF/flankR.

 

Экспрессия гена Amy1UA7 в клетках E.coli

Экспрессионными векторами, содержащими вставку Amy1UA7, были трансформированы компетентные клетки штаммовEscherichiacoli: BL21(DE3), ArcticExpress(DE3)RP и Rosetta(DE3) методом электропорации. Отбор клонов проводили на твердой среде с антибиотиком канамицином в концентрации 50 мкг/мл.

Отобранные трансформанты вносили в бульонЛуриа-Бертани с канамицином и осуществляли культивирование в шейкере-инкубаторе. При достижении оптической плотности OD=0,6 добавляли индуктор изопропил-β-D-тиогалактозид в конечной концентрации 0,5 мМ. Для подбора оптимальных условий апробировались следующие температуры: +18°С, +30°С и +37°С. Культивирование проводили в течение 16 часов при встряхивании 150 об/мин.

 

Очистка рекомбинантной альфа-амилазы Amy1UA7

Очистку рекомбинантного белка Amy1UA7 осуществляли из 400 мл индуцированной культуры. Собранные центрифугированием (6000g, +4°C, 7 минут) клетки были лизированы лизоцимом (2 мг/мл) и ультразвуковым соникированием, как описано ранее [16]. Из полученного белкового экстракта выделение α-амилазы Аmy1UA7 осуществляли металлоаффинной хроматографией на колонке HiTrapChelating(GeneralElectric)объемом 1 мл, активированной ионами Ni2+. Для данной цели был использован препаративныйхроматографFPLCAKTAPurifier 10 (GeneralElectric). Очистку проводили линейным градиентом по имидазолу от 20 мМ до 500 мМ, остальными компонентами элюирующего буфера были: 500 мМNaCl, 20 мМHepes-NaOH (pH 7,5).

 

Биохимическая характеристика рекомбинантной α-амилазыAmy1UA7

Активность a-амилазы определяли по методу Каравея в стандартных условиях (+37°,10 мин) [17]. Метод основан на определении остатка нерасщепленного крахмала по степени интенсивности его реакции с йодом в кислой среде с максимумом поглощения на 650 нм. Измерение проводили на спектрофотометре APEL303 UV. Пересчет активности в международные единицы осуществлялся в соответствии с [18] и согласно расчетам 1 Uравен 1 мл полностью гидролизованного крахмала из 1% раствора за 30 минут.

Температурный оптимум активности a-амилазы  определяли в диапазонеот 0°С до +90°С с шагом в 10°С.Влияние температуры на кинетику инактивации фермента определяли инкубацией смеси с разведенной амилазой в 200 мМNa-фосфатном буфере (рН 6,5) при температуреот +70°С до +90°С с шагом в 10°С в течение 15,30,45 и 60 минут. Изучение активности рекомбинантной α-амилазы в диапазоне рН от 1,5 до 11,0выявляли в соответствии с методикой [18].

При определении влияния ионов металлов реакцию проводили в ацетатном буфере рН=5,5 и в присутствии 5 мМ солей:CdCl2, CuSO4, NiCl2, KCl, CaCl2, FeCl3, обеспечивающих образование одно-, двух- и трехвалентныхионов (Cd1+, Cu2+, Ni2+, K1+, Ca2+, Fe3+). Влияние органических кислот на активность фермента определяли в промежутке времени от 0 до 9 минут реакции. В качестве органических кислот использовались: лимонная, молочная, уксусная и аскорбиновая кислоты в концентрации 5 мМ. Влияние вышеперечисленных факторов оценивали по динамике убыли крахмала.

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Ген альфа-амилазыAmy1UA7 был клонирован в составе двух генно-инженерных конструкций: pET28c(+)/amy1UA7-6His иpET28c(+)/6His-amy1UA7-6His. Обе конструкции показали одинаковый уровень экспрессии гетерологичного гена в клетках E.coli, но в плане очистки более результативной оказалась плазмидная конструкция, содержащая гексагистидиновую метку с N-и C-конца, которую использовали для дальнейших работ и переименовали в pAmy1UA7. Вторая конструкция не обеспечивала должный уровень аффинности целевого белка к ионам никеля, в результате чего целевой белок проскакивал сквозь колонку.

В результате трансформации компетентных клеток трех штаммов E.coli, характеризуемых различным генотипом, были получены штаммы-продуценты рекомбинантной a-амилазы. Было установлено, что наиболее эффективным хозяйским штаммомявляется BL21(DE3), а температура культивирования +30°С. При использовании других штаммов экспрессия гена amy1UA7быланесколькониже, а при использовании температуры в +37°С наблюдаетсябольший переход рекомбинантного белка из водорастворимого состояния в водонерастворимое с образованием телец включения. На рисунке 1 представлены результаты индукции.

1,2,3 – полныелизаты; 4,5,6 – осадок; 7,8, 9 – осветленные лизаты; М – маркер
Рис. 1. Проверка индукции белка Amy1UA7 в клетках BL21(DE3)/pAmy1UA7

1,2,3 – total lysates; 4,5,6 – pellet; 7,8,9 –preclarifiedlysates; M – marker
Fig.1. Checking Amy1UA7 protein induction in cells BL21 (DE3) / pAmy1UA7
 
1,2,3 – полныелизаты; 4,5,6 – осадок; 7,8, 9 – осветленные лизаты; М – маркер
Рис. 1. Проверка индукции белка Amy1UA7 в клетках BL21(DE3)/pAmy1UA7

1,2,3 – total lysates; 4,5,6 – pellet; 7,8,9 –preclarifiedlysates; M – marker
Fig.1. Checking Amy1UA7 protein induction in cells BL21 (DE3) / pAmy1UA7

 

Было наработано 400 мл индуцированной с помощью ИПТГ культуры рекомбинантного штамма BL21(DE3)/pAmy1UA7 из лизата, которой выделяли рекомбинантную a-амилазуAmy1UA7. На рисунке 2 представлены результаты очистки рекомбинантной α-амилазы Аmy1UA7.

1 – неиндуцированныйлизат; 2 – белковый экстракт, прошедший сквозь колонку с Ni2+; 3 – смыв с колонки буфером с 20 мМHepes-NaOH (pH 7,5), 500 мМNaCl, 20 мМ имидазола; 4 – смыв с колонки буфером с 20 мМHepes-NaOH (pH 7,5), 500 мМNaCl, 100 мМ имидазола; 5 – хроматографическаяфракция №14; 6 –хроматографическая фракция №15; 7 –хроматографическая фракция №16; 8 –хроматографическая фракция №17; 9 – маркер
Рис. 2.Хроматограмма очистки белка Аmy1UA7 (а) и белковый электрофорез фракций (б)

1 –uninducedlisate; 2 – protein extract, passed through a column of Ni2+; 3 – flush the column buffer 20 мМHepes-NaOH (pH 7,5), 500 мМNaCl, 20 мМ imidazole; 4 – flush the column buffer 20 мМHepes-NaOH (pH 7,5), 500 мМNaCl, 100 мМ imidazole; 5 – chromatographic fractions №14; 6 – chromatographic fractions №15; 7 – chromatographic fractions №16; 8 – chromatographic fractions №17; 9 – marker
Fig.2. The chromatogram of protein purification Amy1UA7 (a) and protein electrophoresis fractions (b)
 
1 – неиндуцированныйлизат; 2 – белковый экстракт, прошедший сквозь колонку с Ni2+; 3 – смыв с колонки буфером с 20 мМHepes-NaOH (pH 7,5), 500 мМNaCl, 20 мМ имидазола; 4 – смыв с колонки буфером с 20 мМHepes-NaOH (pH 7,5), 500 мМNaCl, 100 мМ имидазола; 5 – хроматографическаяфракция №14; 6 –хроматографическая фракция №15; 7 –хроматографическая фракция №16; 8 –хроматографическая фракция №17; 9 – маркер
Рис. 2.Хроматограмма очистки белка Аmy1UA7 (а) и белковый электрофорез фракций (б)

1 –uninducedlisate; 2 – protein extract, passed through a column of Ni2+; 3 – flush the column buffer 20 мМHepes-NaOH (pH 7,5), 500 мМNaCl, 20 мМ imidazole; 4 – flush the column buffer 20 мМHepes-NaOH (pH 7,5), 500 мМNaCl, 100 мМ imidazole; 5 – chromatographic fractions №14; 6 – chromatographic fractions №15; 7 – chromatographic fractions №16; 8 – chromatographic fractions №17; 9 – marker
Fig.2. The chromatogram of protein purification Amy1UA7 (a) and protein electrophoresis fractions (b)

 

Как видно из хроматограммы и электрофореграммы, целевой белок Amy1UA7 хорошо сорбировался на ионах Ni2+, не элюировал с колонки при низкой концентрации имидазола и начал элюировать с колонки при достижении концентрации имидазола 175 мМ (рисунок 2а). Элюция продолжалась до достижения концентрации 200 мМ имидазола и, что примечательно, белок Amy1UA7 сошел с колонки одним пиком (фракции 14-17). Электрофорез фракций, соответствующих хроматографическому пику, показал, что фракции 14-17 содержат α-амилазу с высокой электрофоретической чистотой (рисунок 2б). Выход Amy1UA7 составил 10 мг с 1 литра бактериальной культуры.

Изучение влияния температуры на активность a-амилазы Amy1UA7 показало, что эффективность гидролиза крахмала рекомбинантной α-амилазы Amy1UA7 увеличивается с ростом температуры до +50°С…+55°С, при которой амилазная активность имеет максимальное значение 165 U (активных единиц)(рисунок 3а). Инкубация фермента при температуре +70°С в течение 15 минут полностью инактивирует α-амилазу Amy1UA7.

Ферментативную реакцию проводили в стандартных условиях при +37°С, рН= 6,8 (фосфатный буфер), время инкубации 6 минут. Активность амилазы при стандартных условиях составила: 75-80 U/мл, что соответствует 125-130 мг гидролизованного крахмала за 1 минуту.

Рис.3. Активность рекомбинантной α-амилазы Amy1UA7в диапазоне температур от +10°С до +90°С (а) и рН от 1,5 до 11 (б)
Fig.3. The activity of the recombinant α-amylases Amy1UA7 at temperatures ranging from 10°C to 90°C (a) and a pH from 1.5 to 11 (b)
 
Рис.3. Активность рекомбинантной α-амилазы Amy1UA7в диапазоне температур от +10°С до +90°С (а) и рН от 1,5 до 11 (б)
Fig.3. The activity of the recombinant α-amylases Amy1UA7 at temperatures ranging from 10°C to 90°C (a) and a pH from 1.5 to 11 (b)

 

Как показали результаты эксперимента,α-амилаза Amy1UA7 не проявляет ферментативной активности при рН ниже 2,5. При снижении кислотности наблюдается резкое возрастание амилазной активности, которая достигает максимума в 145 U при рН7,0. После этого активность начинает плавно убывать, достигая 100 U, при pH9,0. Из представленных данных следует, что α-амилаза активна в широком диапазоне рН (от 4 до 9), сохраняя при этом более 80% от максимального значения активности (рисунок 3б).

При изучении влияния ионов металлов на активность a-амилазы Amy1UA7 установлено, что присутствие ионов кадмия и меди в реакционной среде полностью инактивируют ферментAmy1UA7. На представленном графике активность α-амилазы Amy1UA7 для кадмия и меди равна нулю и совпадает с осью абсцисс (рисунок 4). Для ионов железа(III) наблюдается резкое ингибирование биохимической реакции в 8-9 раз, а ионы никеля вызывают ингибирование активности в среднем в 2 раза.

Рис.4. Активность рекомбинантной α-амилазы Amy1UA7в присутствии ионов металлов K1+, Ca2+, Fe3+ (а) и Cd1+, Cu2+, Ni2+ (б)
Fig.4.Theactivityoftherecombinantα-amylasesAmy1UA7 inthepresenceofmetalionsK1+, Ca2+, Fe3+ (a) andCd1+, Cu2+, Ni2+ (b)
 
Рис.4. Активность рекомбинантной α-амилазы Amy1UA7в присутствии ионов металлов K1+, Ca2+, Fe3+ (а) и Cd1+, Cu2+, Ni2+ (б)
Fig.4.Theactivityoftherecombinantα-amylasesAmy1UA7 inthepresenceofmetalionsK1+, Ca2+, Fe3+ (a) andCd1+, Cu2+, Ni2+ (b)

 

Для ионов калия выявлена незначительная тенденция к ускорению реакции и, соответственно, увеличению активности на 12% на 6-й минуте. Для ионов кальция наоборот – выявленатенденция к замедлению реакции, почти на такую же величину. Но данные различия незначительны и, судя по характеру кривых, находятся в пределах ошибки.

Изучение остаточной активности рекомбинантной α-амилазы к воздействию органических кислот не показало заметного влияния на активность фермента. Уксусная, молочная и лимонная кислоты в концентрации 5 мМ не оказывают какого-либо заметного влияния на активность рекомбинантной α-амилазы Amy1UA7 (рисунок 5).

Рис. 5.Активность рекомбинантной α-амилазы Amy1UA7в присутствии органических кислот
Fig.5.The activity of the recombinant α-amylases Amy1UA7 in the presence of organic acids
 
Рис. 5.Активность рекомбинантной α-амилазы Amy1UA7в присутствии органических кислот
Fig.5.The activity of the recombinant α-amylases Amy1UA7 in the presence of organic acids

 

Определить влияние аскорбиновой кислоты не представилось возможным, так как аскорбиновая кислота обесцвечивает йод-крахмальный комплекс.

 

ЗАКЛЮЧЕНИЕ

Таким образом, на основании полученных результатов можно констатировать, что a-амилазу Amy1UA7 из Bacillussubtilis можно успешно получить в рекомбинантной форме путем экспрессии соответствующего гена в гетерологичных для него условиях. В ходе изучения биохимических параметров рекомбинантной a-амилазы Amy1UA7 определен температурный и кислотный оптимум рекомбинантного фермента. Установлено, что максимальную активность рекомбинантная α-амилазаAmy1UA7 имеет при +50°С…+55° и при рН 7,0, которая составляет 165U, что сопоставимо с активностью нативныхa-амилаз[18]. Полученные данные по температурному оптимуму и остаточной активности являются существенными для применения рекомбинантного фермента в биотехнологических процессах, так как имеется возможность регуляции процесса осахаривания субстрата путем изменения температуры. В то же времяa-амилаза Amy1UA7сохраняет активность в диапазоне рН от 4 до 9, что является полезной характеристикой для использования α-амилазы Amy1UA7 в биотехнологии, так как толерантность к рН обеспечивает определенную универсальность рекомбинантного ферментав биотехнологических процессах, где возможны сильные вариации кислотности реакционной смеси. Наряду с толерантностью к варьированию кислотности, выявлено отсутствие влияния уксусной, молочной и лимонной кислот на амилазную активность. Данные характеристикитакже имеют определенную ценность, так как при гидролизе биополимеров в реакционной среде возможно присутствие различных органических кислот в качестве продуктовбиопроцессов.

При изучении влияния ионов металлов на активность α-амилазы Amy1UA7 установлено, что ионы калия, кальция и никеля не влияют существенным образом на активность рекомбинантного фермента, в то время как присутствие в реакционной среде ионов кадмия и меди полностью инактивирует амилазную активность Amy1UA7. Таким образом α-амилазаAmy1UA7 является кальций независимым ферментом. Вышеперечисленные характеристики рекомбинантной α-амилаза демонстрируют перспективность использования Amy1UA7 в биотехнологии.

 

Финансирование

Данная работа выполнена в рамках НТП «Промышленные биотехнологии» по проекту 01.02 «Разработка технологии получения рекомбинантной альфа-амилазыдля пищевой и перерабатывающей промышленности», финансируемой Министерством образования и науки Республики Казахстан.

 

REFERENCES

 

  1. Van der Maarel M.J., Van der Veen B., Uitdehaag J.C., Leemhuis H., Dijkhuizen L. Properties and applications of starch-converting enzymes of the alpha-amylase family. J Biotechnol,2002, vol. 94, no.2, pp. 137-155.
  2. Gupta R., Gigras P., Mohapatra H., Goswami V.K., Chauhan B. Microbial α-amylases: a biotechnological perspective. Process Biochem., 2003, vol.38, no.11, pp. 1599-1616.
  3. Prakash O., Jaiswal N. Аlpha-Amylase: an ideal representative of thermostable enzymes. ApplBiochemBiotechnol, 2010, vol.160, pp. 2401-2414.
  4. Mozhaev V.V. Mechanism-based strategies for protein thermostabilization. Trends Biotechnol., 1993, vol.11, no.3, pp. 88-95.
  5. Schallmey M., Singh A., Ward O.P. Developments in the use of Bacillus species for industrial production. Can J Microbiol.,2004, vol.50, no.1., pp. 1-17.
  6. IgarashiK., HatadaY., HagiharaH., SaekiK., TakaiwaM., UemuraT., Ara K., Ozaki K., KawaiS., KobayashiT., Ito S. Enzymatic properties of a novel liquefying alpha-amylase from an alkaliphilic Bacillus isolate and entire nucleotide and amino acid sequences. ApplEnvironMicrobiol., 1998, vol.64, no.9, pp. 3282-3289.
  7. Hagihara H., Igarashi K., Hayashi Y., Endo K., Ikawa-Kitayama K., Ozaki K., Kawai S., Ito S. Novel alpha-amylase that is highly resistant to chelating reagents and chemical oxidants from the alkaliphilic Bacillus isolate KSM-K38. Appl Environ Microbiol., 2001, vol.67, no.4, pp. 1744-1750.
  8. Liu H.L., Wang W.C. Protein engineering to improve the thermostability of glucoamylase from Aspergillus awamori based on molecular dynamics simulations. Protein Eng., 2003, vol.16, no.1, pp. 19-25.
  9. Mattanovich D.,Branduardi P.,Dato L.,Gasser B.,Sauer M.,Porro D. Recombinant protein production in yeasts.MethodsMolBiol., 2012, vol.824, pp. 329-358.
  10. KachanA.V., RusO.B., EvtushenkovA.N.Клонирование гена α-амилазы bacillussp. 406 и анализ её нуклеотидной и аминокислотной последовательностей [Cloningofgene α-amylasebacillussp. 406 andanalysisofnucleotideandaminoacidsequence]. Proceedings of the Belarusian State University: scientific journal, 2009, t.4, vol.1.
  11. Laemmli U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 1970, vol. 227, pp. 680-685.
  12. Maniatis T., Fritsch E.E., Sambrook J. Molecular cloning. A laboratory manual. New York: Cold Spring Harbor Laboratory, 1982, pp. 545.
  13. Khassenov B.B., Sultankulov B.M., Kozhahmetov S.S., Akhmetov S.B., Ramanklov E.M., Mukanov K.K. Получениерекомбинантногоантигеналейкозавирусакрупногорогатогоскота p24 [Producing a p24 recominant antigen of bovine leucosis virus]. Biotechnology. Theory and Practice, 2011, no. 2, pp.50-56.
  14. Abeldenov S.K. Cloning, expression and purification of recombinant analog of Taq DNA polymerase. Biotechnology. Theory and Practice, 2014, no.1, pp.12-16.
  15. Mussakhmetov A., Nurmagambetova A., Abeldenov S., Khassenov B. Purification of recombinant Pfu DNA polymerase by double step affinity chromatography. Biotechnology. Theory and Practice, 2014, no.2, pp. 42-47.
  16. Abeldenov S., Kirillov S., Nurmagambetova A., Kiribayeva A., Silayev D., Khassenov B. Expression and purification and biochemical characterization of recombinant phosphohydrolaseappa in Esherichia coli. Biotechnology. Theory and Practice, 2014, no.3, pp. 61-65.
  17. Kamyshnikov V.S.Клинико-биохимическаялабораторнаядиагностика: Справочник [Clinical and biochemical laboratory diagnostics: Reference].Moskow, Interpressservice, 2003, pp. 495.
  18. Young J. Yo O., Juan Hong., Randolph T. Hatch. Comparison of a-Amylase Activities from Different Assay Methods.Biotechnology and bioengineering, July 1987, vol. 30, pp. 147-151.

 

ESCHERICHIA COLI ЖАСУШАСЫНДА BACILLUS SUBTILIS -ТАН РЕКОМБИНАНТТЫ Α-АМИЛАЗА AMY1UA7 АЛУ

 

Калимқұлова М., Кірібаева А., Мұхамедьяров Д., Құламетов Ж., Ахметоллаев И., Силаев Д., Хасенов Б.
Ұлттық биотехнология орталығы
Қорғалжын тас жолы, 13/5, Астана, 010000, Қазақстан
asel_january@mail.ru

 

ТҮЙІН

Крахмалдан тұратын шикізаттың гидролизын жүзеге асыратын ферменттер, қазіргі заманғы биотехнологиялық өндірісте кеңінен қолданылады. Ұсынылған жұмыста a-амилаза Amy1UA7 биохимиялық параметрлерін зерттеу үшін Bacillus subtilis – тан рекомбинантты формада жасушада Escherichia coli алынды. Аmy1UA7 гені олигонуклеотидтерден синтезделді және Т7 бактериофагы промотор бақылауымен рЕТ-28с(+) векторы құрамында клондалды. BL21(DE3) штамм жасушаларында геннің плазмидті экспрессия жолымен рекомбинантты ақуыз Amy1UA7 алынды, оны тазарту металлоафинды хроматография әдісімен жүргізілді. Зерттеу барысында рекомбинантты ферменттің температуралық және қышқылдық оптимумы анықталды, металлиондарының және органикалық қышқылдардың ферменттік  белсенділікке әсері анықталды. Amy1UA7 a-амилазаның белсенділігіне температураның әсерін зерттеу келесіні көрсетті, рекомбинантты Amy1UA7α-амилазаның крахмал гидролизының тиімділігі температураның +50°С-+55°С дейін жоғарылауымен көбейеді, бұл жағдайда амилазалық белсенділік 165 U максималды маңызға ие болады. Анықталғандай, Amy1UA7 α-амилаза рН (4 тен - 9 дейін) кең диапазонында белсенділіктің максималды маңызынан 80% дан артық сақтай отыра белсенді. Amy1UA7 α-амилаза органикалық қышқылдар мен металл иондары қатарына толеранттылыққа ие болатын, кальцийге тәуелсіз фермент болып табылады.

Алынған мәліметтер полисахаридтер гидролизында биотехнологиялық процесстарда рекомбинантты ферментті қолдану үшін маңызды болып табылады.

Негізгі сөздер: a-амилаза, Bacillus, рекомбинантты фермент, амилазалық белсенділік.