4/2015

 

УДК 577.213.32:577.217.5:577.218:577.29:541.515

 

КЛОНИРОВАНИЕ И ЭКСПРЕССИЯ РЕКОМБИНАНТНОГО БЕЛКА УБИКВИТИНА ЧЕЛОВЕКА, КОНЪЮГИРОВАННОГО С ПЕПТИДОМ АКЦЕПТОРОМ БИОТИНА

 

Кулыясов А.Т.1, Жубанова Г.С.1, Раманкулов Е.М.1, Огрызько В.В.2
1 Национальный центр биотехнологии
Кургальжинское шоссе, 13/5, г. Астана, 010000, Казахстан
2Institut Gustave Roussy, CNRSUMR8126
94805, 39 Rue Camilles Desmoulin, Villejuif, France
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

АБСТРАКТ

Разработанный нами метод, названный ProximityUtilizingBiotinylation (PUB) или биотинилирование от сближения (взаимодействия) белков invivo, основан на совместной экспрессии внутри одной клетки рекомбинантных белков – интересующего белка с биотин лигазой BirA и его партнера с пептидом акцептором биотина BAP, что позволяет провести точную количественную оценку степени их взаимодействия.

Целью данной работы является получение плазмидной констукции, содержащей ген убиквитина человека UbC, конъюгированный с пептидом акцептором биотина BAP и его экспрессия в клетках НЕК293Т.

В экспериментах по экспрессии белковBAP-убиквитин и BirA-HP1g (BirA-GFP, контроль) в клетках HEK293Tвыявлена более высокая специфичность взаимодействия (биотинилирования) в случае белка BirA-HP1gв сравнении с контролем BirA-GFP. На примере другой модельной системы обнаружен более высокий уровень белок-белкового взаимодействия BirA-Tip49 с различными убиквитинированными белками в сравнении с BirA-Tap54.

Ключевые слова: белок-белковые взаимодействия, биотинилирование, биотин-лигаза, пептид акцептора биотина, плазмиды, транзиентная трансфекция, иммуноблот, убиквитин.

 

CLONING AND EXPRESSION OF RECOMBINANT PROTEIN OF HUMAN UBIQUITIN, FUSED WITH BIOTIN ACCEPTOR PEPTIDE

 

Kulyyassov A.T.1, Zhubanova G.S.1, Ramanculov E.M.1, Ogryzko V.V.2
1National Center for Biotechnology
13/5, K orgalzhyn Rd, Astana, 010000,Kazakhstan
2Institut Gustave Roussy, CNRS UMR8126
94805, 39 Rue Camilles Desmoulin, Villejuif, France
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

The proximity utilizing biotinylation (PUB) method is based on co-expression within a single cell of recombinant proteins. It involves fusion of the protein of interest with biotin ligase BirA and that of its partner with the biotin acceptor peptide (BAP). The method allows an accurate quantitative assessment of the extent of their interaction in vivo.

The aim of this study was to construct a new plasmid vector containing human ubiquitin UbC fused with a BAP and to evaluate its expression in HEK293T cells.

To test the model system, we evaluated the protein expression of ubiquitin-BAP and BirA-HP1g (BirA-GFP, control) in HEK293T cells, and we observed a high specificity interaction (biotinylation) in the case of BirA-HP1g versus the control BirA-GFP. In another example of the model system, we observed higher levels of protein-protein interaction of BirA-Tip49 with different ubiquitinated proteins, compared to BirA-Tap54.

Keywords: protein-protein interactions, biotinylation, biotin ligase, biotin acceptor peptide, plasmids, transient transfection, western blot, ubiquitin.


 

ВВЕДЕНИЕ

Пост-трансляционные модификации (Post-translationmodification, PTM) белков убиквитиномвовлечены во множество биологических процессов, включая круговорот белков, ДНК-репарацию и репликацию, сигнальные пути, контроль клеточного цикла, эмбриогенез, регуляцию цитоскелета, метаболизм, гомеостаз и РНК-процессинг [1-2].

Присоединение убиквитина к белку является обратимым событием и может осуществляться как в виде мономера, так и в виде различных типов полиубиквитиновых цепей. В результате такой модификации субстратный белок может претерпевать протеолитическую деградацию протеасомами или лизосомами, изменить свою субклеточную локализацию или активность, а также взаимодействие с другими белками [3]. Поскольку убиквитинирование является важным регуляторным механизмом в сигнальных путях внутри клетки, то нарушение процессов, связанных с убиквитинированием, может привести к различным заболеваниям, включая рак [4].

Вследствие огромного значения и разносторонних функций убиквитинирования в процессах передачи сигналов в клетке появилась возможность точного подбора мишеней для новых лекарственных препаратов. Первое в этом ряду разработанное в США средство «Бортезомиб» является ингибитором протеасомы, компонента убиквитиновой системы, было одобрено FDA в 2003 году [5]. Доходы от продажи этого препарата составляют 1,4 миллиарда долларов США. Сегодня более 30 новых ингибиторов элементов, связанных с убиквитином белками, находятся на различных стадиях клинических испытаний в качестве средств для лечения множественной миеломы, лейкемии, рака печени и легких [4-6].

 

МАТЕРИАЛЫ И МЕТОДЫ

Клонирование ДНК. Получение плазмидных конструкции, содержащих ген UbC

Для получения гена UbC проведен дизайн олигонуклетидов-праймеров, содержащих сайты узнавания для эндонуклеаз рестрикции XhoI и NotI, что позволило провести клонирование по этим сайтам в векторную плазмиду pcDNA3.1(+).BAP.

Праймеры (подчеркнуты сайты рестрикции XhoI и NotI):

Primer 1 UbC:

CACACACACTCGAGGGCATGCAGATCTTCGTGAAGACCCTGACTGGTAAGACCAT

Primer 2 UbC AS:

TGTGTGTGGCGGCCGCTACCCACCTCTGAGACGGAGGACCAGGTGCAGGGTGGACTCTT

В качестве матрицы для ПЦР-амплификации гена UbC использовали плазмиду pBBHN.UbC. Полученный ампликон гена UbC клонировали в вектор pcDNA3.1(+).BAP1070. Условия ПЦР: денатурация 94°С - 15 сек, отжиг 54°С - 30 сек, элонгация 72°С - 1 мин, количество циклов – 20.

Смесь 1. Праймеры (Primer 1 UbC, Primer 2 UbC AS) –0,5 мкл, pBBHN.UbC (200 мкг) –0,5 мкл, Н2О – 18,5 мкл, dNTP (2,5 мМ)– 5,0 мкл. Общий объем – 25,0 мкл.

Смесь 2. Буфер ПЦР с KCl (5х) – 10,0 мкл, MgSO4– 10,0 мкл, Pwo ДНК-полимераза (Roche, 11 644 947 001) – 1,0 мкл, Н2О – 4,0 мкл. Общий объем – 25,0 мкл.

Смешали смеси 1 и 2 и загрузили в ПЦР амплификатор. Часть продуктов ПЦР-реакции (10 мкл или 1/5 часть от объема) для визуализации подвергали электрофорезу в 0,8% агарозном геле, затем окрашивали с помощью бромистого этидия. Оставшуюся часть ПЦР-продуктов (40 мкл) поместили в пробирки с фильтрующими элементами из набора для очистки продуктов ПЦР фирмы Millipore (номер по каталогу P36461, Rev.A, 03/05) и добавили 300 мкл воды. Для удаления солей и праймеров откручивали в центрифуге при 1000 g в течение 15 мин. Далее в фильтрующий элемент, содержащий амплифицированную ДНК, добавляли 20 мкл воды, переворачивали, вставляли в новую пробирку из набора и центрифугировали 2 мин при 1000 g.

Векторную ДНК pcDNA3.1(+).BAP.H2Az (1 мкг), а также продукт ПЦР-амплификации гена UbC подвергали гидролизу рестриктазамиXhoI и NotI (20 е.а. в 20 мкл реакционной смеси) в соответствующих буферных растворах при 37°С в течение 2 часов. Гидролизат разделяли электрофорезом в 0,8% агарозном геле, затем окрашивали с помощью бромистогоэтидия [7]. Визуализированные в УФ-свете фрагменты вырезали, помещали кусочки геля в пробирки, из набора для выделения ДНК из агарозного геля фирмы Millipore (номер по каталогу LSKGEL050) и центрифугировали при 5000 g, 10 мин. Лигирование полученных на предыдущей стадии вектора и фрагмента ДНК осуществляли с помощью лигазы фага Т4 в течение ночи при 14°С.

После трансформации компетентных клеток E. coli штамма DH5a, и отбора клонов, несущих рекомбинантные плазмиды со встроенным геном, получали плазмиду pcDNA3.1(+).BAP.UbC. Вектора, не содержащие эндотоксины, нарабатывали с помощью наборов для выделения плазмидной ДНК (Sigma, PLED35-1KT или Qiagen, 12362), согласно протоколам,приведенным в инструкциях или на сайтах компаний-производителей.

 

Секвенирование ДНК

Первичную структуру ДНК определяли с использованием наборов BigDyev.3.1 (Lifetechnologies, 4337455) на автоматических анализаторах ДНК AB3730xl (AppliedBiosystems) с использованием праймеровpcDNA3.1_FP (5’ CTCTGGCTAACTAGAGAAC 3’)и primer2EMC (5’ AGACGGCAATATGGTGGA3’).

Для проведения реакции использовали 2.5х ReadyReactionpremix (AppliedBiosystems, N4337455), 5xBigDyeSequencingbuffer, FD и RSпраймеры, матрицу и дополнили до 20 мкл водой. 

Программа для сиквенс-ПЦР: 1 мин – 96°С, 10 сек – 96°С (денатурация), 5 сек – 50°С (отжиг), 4 мин – 60°С (элонгация), хранение при +10°С. Количество циклов – 25.

Выделение ДНК: Реакционную смесь осадили смесью этанола (90%) и ацетата натрия (3М). Перемешали и открутили при 7000 об., 45 минут при 4°С, удалили супернатант. Промыли 140 мкл 70% этанола, открутили при 7000 об., 15 минут при 4°С, удалили супернатант. Высушили в течение 15 минут (в темноте) при комнатной температуре для удаления этанола и добавили 14 мклформамида (Hi-Di, AppliedBiosystems, N4311320) в каждую пробирку, выдержали 5-10 минут, денатурировали при 95°С 2-3 минуты. Перенесли на плашку для сиквенса. Провели сиквенс, а полученные хроматограммы анализировали при помощи программы MEGA4.

 

Транзиентнаятрансфекция клеток HEK293T

Экспрессию рекомбинантных белков из полученных плазмидpcDNA3.1(+).BAP.UbC, pcDNA3.1(+).BirP.HP1g и pcDNA3.1(+).BAP.GFP осуществляли в клетках HEK293T (Humanembryonickidneycells) с применением кальций-фосфатного метода [8].

За 1 день до трансфекции посеяли 200000 клеток HEK293T в каждую лунку 6-луночной планшеты в 2 мл среды DMEM, содержащей 10% фетальной телячьей сыворотки и 1% смеси антибиотиков пенициллина и стрептомицина. На следующий день за 1 час до трансфекции  поменяли среду на свежую 2 мл DMEM. Для проведения трансфекции в расчете на 1 лунку приготовили по две пробирки на 1,5 мл, промаркированные 0А, 0В (1А, 1В или 2А, 2В). В одну пробирку (раствор А) загрузили 220 мкл воды, 31 мкл 2М раствора хлорида кальция и рассчитанное количество плазмидных ДНК. Для трансфекции брали 0,5 мкг плазмид, содержащих последовательность, кодирующую пептид мишень CMV.BAP.UbC и 0,3 мкг плазмид, кодирующих биотин-лигазу, например,CMV.BirA.HP1gи CMV.BirA.GFP. Во вторую пробирку (раствор B) загрузили 250 мкл буферного раствора HBS 2x (Состав буферного раствора HBS 2х (200 ml):Hepes 2 г, KCl  0,15 г, Глюкоза 0.4 г, NaCl 3,2 г, Na2HPO4 0,0426 г, pH должно составить 5,9, довели pH до 7,0 добавлением небольшими порциями 1н р-раNaOH, отфильтровали через стерильный фильтр фирмы Millipore и хранили при 4°C). Затем медленно по каплям добавили раствор А к раствору В, оставили на 15 минут и затем добавили полученную смесь к клеткам HEK293T.

На следующий день поменяли средуна свежуюDMEM. Мечение биотином образцов проводили за 30 мин, 1,5 часа, 5 часов и в течение ночи. Для этого поменяли среду на DMEM, приготовленную добавлением 10 мкл раствора биотина (1мг/мл) и 100 мкл 50 мМHEPES (рН 7,35) к 2 мл среды. После мечения биотином клетки собрали, удалили среду, затем добавили 1 мл раствора PBS, ресуспендировали и перенесли в пробирку на 1,5 мл. Затем пробирки центрифугировали при +4°С, 700rcf, 5 минут, удалили супернатант и добавили к клеткам по 100 мкл раствора буфера CSK, содержащего 0,5% тритона (Состав CSK - 100 мMNaCl, 300 мM сахароза, 10 мMTris, pH 7,5, 3 мMMgCl2, 1 мMEGTA, 1,2 мMPMSF, 10 mMйодоацетамида, 0,5% TritonX-100), пипетировали несколько раз и центрифугировали при 4000 rpm, 5 минут. Йодоацетамид добавили в буферный раствор для ингибирования ферментов деубиквитиназ [9].

В результате на данном этапе метода были получены ядра клеток HEK293T, которые можно было заморозить до -20°С или сразу добавить 80 мкл буфера CSK без тритона, подвергнуть соникированию (для разрушения геномной ДНК и уменьшения вязкости) и добавить 40 мкл загрузочного буфера 3Х (Состав на 10 мл: 2,4мл 1М Трис, рН 6,8, 0,8 гSDS, 4 мл глицерина, 0,01% бромфенолового синего, 1 мл бета-меркаптоэтанола и 2,8 мл воды). Пробирки встряхнули, нагрели при 98°С (5 минут) и открутили на миницентрифуге на максимальной скорости. Анализ лизатов ядер с помощью иммуноблоттинга осуществляли согласно методике из сборника [10].

 

Подготовка образцов на Вестерн-блот

Для белкового электрофореза использовали готовые кассеты с градиентным полиакриламидным гелем на 10 лунок (Lifetechnologies № NP0321BOX) и на 12 лунок (Lifetechnologies, № NP0322BOX). В качестве загрузочного буфера использовали 4х NUPAGE LDS samplebuffer (Lifetechnologies, №NP0007). Электрофорез проводили с использованием буферного раствораMOPS(Lifetechnologies, №NP0001).

Для обработки мембран после переноса по Вестерну использовали стрептавидин-HRP (Invitrogen, 43-4323) и анти-His-HRP (QiaGen, 34460).Мембраны обрабатывали смесью, состоящей из 500 мкл Luminol/enhancer solution и 500 мкл Stable peroxide buffer (Applichem, A3417,1200). После экспозиции рентгеновской пленки на мембране пленку проявляли на проявочной машине.

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Для экспериментов по экспрессии и изучения взаимодействий убиквитинированных форм белковinvivo мы сконструировали два типа векторов: один для экспрессии BAP-слитых мишеней, а другой для BirA-слитых белков, которые содержат следующие элементы:

  • Убиквитин (Ubiquitin) – нуклеотидная последовательность гена UbC или любого другого белка, который можно клонировать между сайтами XhoI и NotI с помощью технологии рекомбинантной ДНК. Рамка считывания (ORF) гена белка регуляторного белка убиквитина человека составляет 240 п.н., а масса белка 8,5 кДа.
  • BAP1070 (Biotin Acceptor Peptide) – домен пептида акцептора биотина, который содержит также гептагистидиновый маркер 7His-tag (рисунок 1), для возможности мониторинга или выделения рекомбинантных белков вне зависимости от наличия биотиновой метки [11-22].
  • CMV (Cytomegalovirusenhancer-promoter) цитомегаловирусный промотор.
  • EMCIRES (EncephalomyocarditisInternalRibosomeEntrySite) – последовательность бицистронного транскрипционного элемента, позволяющего экспрессировать два белка из одного транскрипта.
  • IL2R (Interleukin-2 Receptor) – селекционный маркер.

Amp(R) – селекционный маркер гена устойчивости к ампициллину.

Рис. 1. Дизайн вектора для трансфекции в эукариотических клетках на примере конструкции, содержащей ген UBC, слитый с BAP (Конструкция получена на основе стандартной плазмидыpcDNA3.1(+) с CMV промотором)
Fig. 1. Design of vector for transfection in eukaryotic cells on example of vector, containing UbC gene, fused with BAP (Construct was obtained on the basis of plasmid pcDNA3.1(+) with CMV promoter)
 
Рис. 1. Дизайн вектора для трансфекции в эукариотических клетках на примере конструкции, содержащей ген UBC, слитый с BAP (Конструкция получена на основе стандартной плазмидыpcDNA3.1(+) с CMV промотором)
Fig. 1. Design of vector for transfection in eukaryotic cells on example of vector, containing UbC gene, fused with BAP (Construct was obtained on the basis of plasmid pcDNA3.1(+) with CMV promoter)

 

Для получения плазмид, содержащихUbC,и слияния с пептидом акцептором биотина BAP мы спроектировали и заказали соответствующиепраймеры, содержащие рестрикционные сайтыXhoI с N-конца и NotI с С-конца. Последовательности указанных нуклеотидов выравнивали геном UbC с помощью программы MEGA, а отсутствие сайтов XhoI и NotI внутри гена проверяли с помощью программы ChromasPro.

Затем полученные праймеры использовали в ПЦР с использованием высокоточной ДНК-полимеразы Pwo фирмы Roche для амплифицирования гена UbC(рисунок 2а).Амплифицированный фрагмент, а также вектор CMV.BAP обработали рестриктазамиXhoI и NotI, прогнали на 0,8% агарозном геле, окрасили бромистым этидиумом, вырезали из геля, отделили ДНК от агарозы и лигировали Т4 ДНК-лигазой в течение ночи при 4°С (рисунок2b). Лигационную смесь использовали для бактериальной трансформации в Escherichiacoli(штамм DH5 альфа) и высеяли на чашки с LB-агаром, содержащим ампициллин (250 мкг/мл), в соответствии со стандартным протоколом [7]. Выросшие клоны отбирали на наличие вставки гена UbC с помощью ПЦР (рисунок2с). ПЦР-проверка показала наличие вставки требуемого гена UbC во всех клонах.

а – ПЦР гена UbC. Условия ПЦР, 2 минуты 94 °C, 15 секунд 94 °C (денатурация), 30 секунд 56 °C (отжиг), 2 минуты 72 °C (элонгация), 10 минут 72 °C, 20 циклов; в – субклонированиеUbC в pcDNA3.1 вектор. Гель сфотографирован после вырезания векторов и фрагмента из агарозы; с –ПЦР-проверка клонов
Рис. 2. ПЦР и субклонирование гена UBC белка убиквитина человека

a– PCR of UbC gene. PCR conditions: 2 min at 94 °C, 15 sec at 94 °C (denaturation), 30 sec at 56 °C (annealing), 2 min at 72 °C (elongation), 10 min at 72 °C,20 cycles; b – subcloning of UbC into pcDNA3.1(+) vector. Picture of gel was taken after excising of vectors and fragments from agarose; c – Colony PCR of clones
Fig. 2. PCR and subcloning of human UbC gene
 
а – ПЦР гена UbC. Условия ПЦР, 2 минуты 94 °C, 15 секунд 94 °C (денатурация), 30 секунд 56 °C (отжиг), 2 минуты 72 °C (элонгация), 10 минут 72 °C, 20 циклов; в – субклонированиеUbC в pcDNA3.1 вектор. Гель сфотографирован после вырезания векторов и фрагмента из агарозы; с –ПЦР-проверка клонов
Рис. 2. ПЦР и субклонирование гена UBC белка убиквитина человека

a– PCR of UbC gene. PCR conditions: 2 min at 94 °C, 15 sec at 94 °C (denaturation), 30 sec at 56 °C (annealing), 2 min at 72 °C (elongation), 10 min at 72 °C,20 cycles; b – subcloning of UbC into pcDNA3.1(+) vector. Picture of gel was taken after excising of vectors and fragments from agarose; c – Colony PCR of clones
Fig. 2. PCR and subcloning of human UbC gene

 

Для проверки правильности сборки полученных векторов нами проведены трансфекции в клетках НЕК293Т на примерах двух модельных систем: в первом случае проводили совместную экспрессию рекомбинантных белков BAP-Ub+BirA-HP1g (или BirA-GFP, в качестве контроля)во второй модельной системеBAP-Ub+BirA-Tip49 (или BirA-Tap54, для сравнения).

 

Экспрессия рекомбинантных белков BAP-UbC,BirA-HP1gи BirA-GFP в клетках HEK293T

На рисунке 3 приведены результаты иммуноблоттинга образцов, полученных из ядер клеток HEK293T. В верхней части рисунка мембрана показывает уровень экспрессии белков BirA-HP1gи BirA-GFP, поскольку мембрана обработана антителами на полигистидиновый фрагмент, присутствующий также между BirA и рамкой считывания интересующего белка GFP и HP1g. В нижней части рисунка приведена мембрана, обработанная стрептавидином, конъюгированнымпероксидазойHRP.

Верхнийблот обработан антителами a-His-HRP, нижний антибиотиновыйблот обработан конъюгатомстрептавидин-HRP; 0 – контрольный образец, обработанный реагентом для трансфекции (фосфатом кальция) без плазмид. Время мечения биотином от 30 минут до ON (в течение ночи)
Рис. 3.Уровни биотинилированияубиквитинированных белков, взаимодействующих с интересующими нас белками BirA-GFP и BirA-HP1g, полученные с помощью иммуноблотинга

Top blot was treated with a-His-HRP, bottom blot was treated with streptavidin-HRP; 0 – control, calcium phosphate transfection without plasmid. Biotin pulse from 30 min to ON
Fig. 3.Biotinylation levels on Western blot of ubiquitinated proteins, interacting with protein of interest BirA-GFP and BirA-HP1g
 
Верхнийблот обработан антителами a-His-HRP, нижний антибиотиновыйблот обработан конъюгатомстрептавидин-HRP; 0 – контрольный образец, обработанный реагентом для трансфекции (фосфатом кальция) без плазмид. Время мечения биотином от 30 минут до ON (в течение ночи)
Рис. 3.Уровни биотинилированияубиквитинированных белков, взаимодействующих с интересующими нас белками BirA-GFP и BirA-HP1g, полученные с помощью иммуноблотинга

Top blot was treated with a-His-HRP, bottom blot was treated with streptavidin-HRP; 0 – control, calcium phosphate transfection without plasmid. Biotin pulse from 30 min to ON
Fig. 3.Biotinylation levels on Western blot of ubiquitinated proteins, interacting with protein of interest BirA-GFP and BirA-HP1g

 

Использование различных времен мечения биотином позволило выявить неспецифичностьбиотинилирования в случае BirA-GFP в сравнении с BirA-HP1g. Несмотря на меньший уровень экспрессии BirA-GFP чем BirA-HP1g, что видно из верхнего блота (дорожки 7 и 8), тем не менее, уровень биотилирования всех белков BAP-Ubiquitin заметно выше в случае BirA-GFP (дорожка 7 нижний блот) по сравнению с BirA-HP1g (дорожка 8 нижний блот).Сравнительный анализ результатов Вестерн-блоттинга образцов позволил также обнаружить присутствие биотинилированных форм убиквитинированных модификации BirA-GFP-BAP-Ub, BirA-HP1g-BAP-Ub и гистона H2A-BAP-Ub (указаны линиями на нижнемблоте).

Таким образом, на примере изучения модели белков HP1g и GFP взаимодействующих с убиквитинированными формами белков invivo установлена выраженная специфичность BirA.HP1g  в сравнении с BirA-GFP.

 

Экспрессия рекомбинантных белков BAP-UbC,BirA-Tip49и BirA-Tap54 в клетках HEK293T

Экспрессию рекомбинантных белков из полученных плазмидpcDNA3.1(+).BAP.UbC, pcDNA3.1(+).BirA.Tip49 и pcDNA3.1(+).BirA.Tap54 осуществляли в клетках HEK293T (Humanembryonickidneycells) с применением  кальций-фосфатного метода [8]. Обработку клеток биотином проводили за 30 минут до сбора клеток.

Белки Tip49 и Tap54 участвуют времоделировании хроматина и регуляции транскрипции [23-24], однако в литературе отсутствуют данные, насколько эти белки вовлечены в процессы убиквитинированияinvivo.

На рисунке 4 приведены результаты иммуноблоттинга образцов, полученных из ядер клеток HEK293T. В левой части рисунка мембрана показывает уровень экспрессии белков BirA-Tip49и BirA-Tap54, поскольку мембрана обработана антителами на полигистидиновый фрагмент, присутствующий также между BirA и рамкой считывания интересующего белка Tip49и Tap54. В правой части рисунка приведена мембрана, обработанная стрептавидином, конъюгированнымcпероксидазойHRP. Несмотря на примерно одинаковый уровень экспрессии белков BirA-Tip49и BirA-Tap54, уровень биотинилирования в первом случае (первая дорожка на правом блоте) выше в сравнении с BirA-Tap54 (вторая дорожка на правом блоте). Это свидетельствует о более высоком уровне белок-белкового взаимодействия BirA-Tip49 с различными убиквитинированным белками в сравнении с BirA-Tap54.

Правыйблот обработан антителами a-His-HRP; левый антибиотиновыйблот обработан конъюгатомстрептавидин-HRP. Времямечениябиотином 30 минут
Рис. 4.Уровни биотинилированияубиквитинированных белков, взаимодействующих с интересующими нас белками BirA-Tip49 и BirA-Tap54, полученные с помощью иммуноблотинга

Blot on the right side was treated with a-His-HRP; blot on the left side was treated with streptavidin-HRP. Biotin pulse – 30 min
Fig. 4.Biotinylation levels on Western blot of ubiquitinated proteins, interacting with protein of interest BirA-Tip49 and BirA-Tap54
 
Правыйблот обработан антителами a-His-HRP; левый антибиотиновыйблот обработан конъюгатомстрептавидин-HRP. Времямечениябиотином 30 минут
Рис. 4.Уровни биотинилированияубиквитинированных белков, взаимодействующих с интересующими нас белками BirA-Tip49 и BirA-Tap54, полученные с помощью иммуноблотинга

Blot on the right side was treated with a-His-HRP; blot on the left side was treated with streptavidin-HRP. Biotin pulse – 30 min
Fig. 4.Biotinylation levels on Western blot of ubiquitinated proteins, interacting with protein of interest BirA-Tip49 and BirA-Tap54

 

Таким образом, приведенные данные свидетельствуют о том, что сконструированная плазмидаpcDNA3.1(+).BAP.UbC обеспечивает высокий уровень экспрессии рекомбинантного белка BAP-Ubiquitin, достаточного для работ, связанных с количественной оценкой его экспрессии в эукариотических клетках и изучения белок-белковых взаимодействий invivo.

 

ВЫВОДЫ

Таким образом, по результатам проведенных экспериментов получен вектор, содержащий ген убиквитина человека, конъюгированный с пептидом акцептором биотина BAP. На примере изучения модели белков HP1g и GFP, взаимодействующих с убиквитинированными формами белков invivo, установлена выраженная специфичность BirA.HP1g  в сравнении с BirA-GFP. На модельной системе с участием белков Tip49 и Tap54, участвующих времоделировании хроматинаи регуляции транскрипции, обнаружен более высокий уровеньбелок-белкового взаимодействия BirA-Tip49 с различными убиквитинированными белками в сравнении с BirA-Tap54.

 

Финансирование

Работа выполнена при поддержке Министерства образования и науки Республики Казахстан в рамках проекта 1804/ГФ4 «Новые подходы для изучения и количественного анализа убиквитинированияinvivo, на основе метода биотинилирования от сближения» на 2015-2017 гг. (№ГР0115РК01802).

 

Благодарность

Авторы выражают признательность сотруднику Национальной научной лаборатории биотехнологии коллективного пользования Шевцову А. за помощь в секвенированииплазмидных конструкций, а также сотрудникам лаборатории органического синтеза Национального центра биотехнологии за синтез олигонуклеотидов.

 

REFERENCES

 

  1. Grillari J., Grillari-Voglauer R., Jansen-Durr P. Post-translational modification of cellular proteins by ubiquitin and ubiquitin-like molecules: role in cellular senescence and aging.Adv. Exp. Med. Biol.,2010, vol.694, рр.172-196.
    PubMed
  2. Hochstrasser M. Origin and function of ubiquitin-like proteins.Nature, 2009, vol.458, no. 26, pp.422-429. doi: 10.1038/nature07958.
    PubMed
  3. Welchman R.L., Gordon C. & Mayer R.J. Ubiquitin and ubiquitin-like proteins as multifunctional signals.Nat. Rev. Mol. Cell Biol.,2005, vol.6, рр.599-609.
    CrossRef PubMed
  4. Mani A., Gelmann E.P. The ubiquitin-proteasome pathway and its role in cancer. Journal of clinical oncology, 2005, vol.23, no.21, рр. 4776-4789.
    CrossRef PubMed
  5. Cohen Ph., Tcherpakov M. Will the ubiquitin system furnish as many drug targets as protein kinase? Cell,2010, vol. 143, рр. 686-693.
    CrossRef PubMed
  6. Micel L.N., Tentler P.G., Smith P.G., Eckhardt S.G. Role of ubiquitin ligases and the proteasome in oncogenesis: novel targets for anticancer therapies. Journal of clinical oncology, 2013, vol.31, no. 9, рр.1231-1238.
    CrossRef PubMed
  7. Maniatis T., Fritsch E.F., Sambrook J. Molecular cloning: A laboratory manual. New York, Cold Spring Harbor Laboratory Press, 1989,480p.
  8. Graham F.L., van der Eb A.J. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology, 1973, vol.52, no.2, рр. 456-467.
    PubMed
  9. Stagg H.R., Thomas M., van den Boomen D., Wiertz E.J.H.J., Drabkin H.A.,Gemmill R.M., Lehner P.J. The TRC8 E3 ligase ubiquitinates MHC class I molecules before dislocation from the ER.J. Cell Biol., 2009, vol. 186, no. 5, рр. 685-692.
    CrossRef PubMed
  10. Higgins S.J., Hames B.D. Protein Expression. A practical approach. - Oxford University Press, 1999, 282p.
  11. Kulyyassov A., Shoaib M., Ogryzko V. Use of in vivo biotinylation for chromatin immunoprecipitation.Curr. Protoc. Cell Biol.,2011,chapter 17, unit17.12. - рр.17.12.1-17.12.22.
    CrossRef
  12. Kulyyassov A., Shoaib M., Pichugin A., Kannouche P., Ramanculov E., Lipinski M., Ogryzko V. PUB-MS: a mass spectrometry-based method to monitor protein-protein proximity in vivo.J. Proteome Res., 2011, vol. 10, no.10, рр. 4416-4427.
    CrossRef
  13. Shoaib M., Kulyyassov A., Robin C., Winczura K., Tarlykov P., Despas E., Kannouche P., Ramanculov E., Lipinski M., Ogryzko V. PUB-NChIP – “in vivo biotinylation” approach to study chromatin in proximity to a protein of interest.Genome Research., 2013, vol. 23, no.2, рр. 331-340.
    CrossRef
  14. Kulyyassov A.T., Zhubanova G.S., Ramanculov E.M., Ogryzko V.V. Method of quantitative evaluation of heterochromatin protein HP1 interactions in vivo.Biotechnology. Theory and practice, 2014, no.1, рр.17-27.
    biotechlink.org
  15. Kulyyassov A.T., Zhubanova G.S., Ramanculov E.M., Ogryzko V.V. Quantitative evaluation of interactions of transcription factor Kap1 and heterochromatin protein HP1 in vivo. Biotechnology. Theoryandpractice, 2014, no.3, рр. 12-21.
    biotechlink.org
  16. Пат. Республики Казахстан на изобретение. 2013/1352.1. Рекомбинантная плазмидаpcDNA3.1(+)-BAP-HP1a, кодирующая гетеро-хроматиновый белок человека HP1a и обеспечивающая его экспрессию в клетках НЕК293Т /Кулыясов А.Т., Огрызько В.В., №30034,заявл. 16.10.2013,бюлл. №6,6c.
  17. Пат. Республики Казахстан на изобретение. 2013/1377.1. Рекомбинантная плазмидаpcDNA3.1(+)-BAP-KAP1, кодирующая белок транскрипционного кофактора человека KAP1 и обеспечивающая его экспрессию в клетках НЕК293Т /КулыясовА.Т., ОгрызькоВ.В.,№30035, заявл. 17.10.2013, бюл. №6, 6c.
  18. Kulyyassov A., Robin C., Ramanculov E.M., Ogryzko V.V. Exploring neighborhoods of ubiquitinated proteins with Proximity-Utilizing Biotinylation // Proceedings of 5th International Conf. on Proteomics & Bioinformatics, September 01-03, 2015, Valencia, Spain, рр. 49.
    CrossRef
  19. Kulyyassov A.,Shoaib M., Robin C., Ramanculov E.M., Ogryzko V.V. Application of Proximity Utilizing Biotinylation method for identification of posttranslational modification and ubiquitination in UV-induced DNA repair // Proceedings of 5th International Conf. on Proteomics & Bioinformatics, September 01-03, 2015, Valencia, Spain, рр. 98.
    CrossRef
  20. Kulyyassov A.T.,Zhubanova G.S., Ogryzko V.V. Study of the compartmentalization of cell using proximity utilizing enzymatic ligation // Proceedings of 5th International Conf. on Proteomics & Bioinformatics, September 01-03, 2015, Valencia, Spain, рр.100.
    CrossRef
  21. Kulyyassov A.T.,Ramanculov E.M., Ogryzko V.V. In vivo biotinylation based method for study protein-protein proximity in eucaryote cells.Central Asian Journal of Global Health.,2013, vol. 2, suppl. ISSN 2166-7403,
    CrossRef
  22. Kulyyassov A.T.,Zhubanova G.S., Ramanculov E.M., Ogryzko V.V. Proximity utilizing biotinylation of nuclear proteins in vivo.Central Asian Journal of Global Health.,2014, vol. 3, suppl. ISSN 2166-7403
    CrossRef
  23. Frisch S.M. and Mymryk J.S. Аdenovirus-5 E1A: paradox аnd paradigm.Nat. Rev. Mol. Cell Biol., 2002, vol. 3, рр.441-452.
    CrossRef
  24. Adhikary S. and Eilers M. Transcriptional regulation and transformation by Myc proteins.Nat. Rev. Mol. Cell Biol., 2005, vol. 6, рр.635-645.
    CrossRef

 

БИОТИН АКЦЕРТОРЫ ПЕПТИДІМЕН КОНЪЮГИРЛЕНГЕН АДАМНЫҢ УБИКВИТИН РЕКОМБИНАНТТЫ АҚУЫЗЫН КЛОНДАУ ЖӘНЕ ЭКСПРЕССИЯЛАУ

 

Құлыясов А.Т.1, Жұбанова Г.С.1, Раманқұлов Е.М.1, Огрызько В.В.2
1Ұлттық биотехнология орталығы
Қорғалжын тас жолы 13/5, Астана қ., 010000, Қазақстан
2Institut Gustave Roussy, CNRS UMR8126
94805, 39 Rue Camilles Desmoulin, Villejuif, France
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Proximity Utilizing Biotinylation (PUB), немесе in vivo ақуыздардың жақындасудан (өзара әрекеттесу) биотинилденуі деп аталатын біз жасаған әдіс BirAлигаза биотинімен нысанды ақуызның және оның серіктесі BAP биотинінің пептид акцепторының – бір жасушаның ішінде рекомбинанттық ақуыздардың біріге экспрессиялануына негізделген, ол олардың өзара әрекеттесу дәрежесіне нақты сандық бағалау жүргізуге мүмкіндік береді.

Осы жұмыстың мақсаты BAP биотинінің пептид акцепторымен конъюгирленген, UbC адамның убиквитин гені бар плазмидалық конструкция алу және оның НЕК293Т жасушаларында экспрессиялау болып табылады. HEK293T жасушаларында BAP-убиквитин жәнеBirA-HP1g (BirA-GFP, бақылау) ақуыздарының экспрессиясы бойынша эксперименттерде BirA-HP1g жағдайында BirA-GFP бақылаумен салыстырғанда өзара әрекеттесудің к(биотинилирование) жоғары спецификалылығы анықталды. Басқа үлгілік жүйе мысалында BirA-Tap54 бақылауымен салыстырғанда BirA-Tip49-мен әртүрлі убиквитинді ақуыздардың жоғары дәрежеде ақуыз-ақуыздық өзара байланысы анықталды.

Негізгі сөздер: ақуыз-ақуыздық өзара байланыс, биотинилдену, биотин-лигаза, биотиннің пептид акцепторы, плазмидалар, транзиентті трансфекцция, иммуноблот, убиквитин.