3/2017
Amirgazin A.O.1, Shvedyuk V.B.1, Kuibagarov M.A. 1, Karibaev T.B.2, Shevtsov A.B.1
1National Center for Biotechnology
13/5, Korgalzhyn road, Astana, 010000, Kazakhstan
2National Reference Center for Veterinary Medicine
22/3, 150 let Abaya str., Astana, 010000, Kazakhstan

This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

Polymerase chain reaction (PCR) is a multifunctional tool used extensively in molecular biology. PCR is modified in numerous ways for specific purposes, all of which rely on proper efficiency, specificity and sensitivity. Despite the general acceptance of the "classical" principle, there is no unified optimization scheme that takes into account the diversity of PCR applications. Such an optimization scheme would guide researchers toward the best optimization approaches for their specific PCR application. Currently, researchers are guided only by data from previously published authors who submitted their own PCR optimization schemes. Here, we describe a PCR protocol optimization algorithm for the detection of microorganisms using Pasteurella multocida as an example. P. multocida, which we have use dextensively in the past, allows us to achieve the necessary PCR specificity and sensitivity to demonstrate the application of our algorithm. Our scheme differs from others as it uses an inductive method to learn the specificity of the protocol being developed. Our approach uses real-time PCR, with SYBR Green I, to monitor amplification during the optimization process. Furthermore, the simplicity of this approach means that it can be used to develop and optimize diagnostic PCR for a wide range of researchers and applications. As a proof of concept, PCR conditions were optimized for two pairs of primers which were tested on a collection of samples comprising DNA from 92 species of bacteria, three eukaryotic species, and with the sensitivity of at least five P. multocida genomic copy equivalents.

Keywords: PCR, optimization, Pasteurella multocida.


УДК 57.081

 

 

АЛГОРИТМ ОПТИМИЗАЦИИ ПЦР ПРОТОКОЛА ДЛЯ ВЫЯВЛЕНИЯ МИКРООРГАНИЗМОВ НА ПРИМЕРЕ Pasteurella multocida

 

АмиргазинА.О.1, ШведюкВ.Б.1, КуйбагаровМ.А. 1, КарибаевТ.Б.2, ШевцовА.Б.1
1Национальный центр биотехнологии
Кургальжинское шоссе, 13/5, Астана, 010000, Казахстан
2Национальный референтный центр по ветеринарии
ул. 150 лет Абая, дом 22/3, Астана, 010000, Казахстан

This email address is being protected from spambots. You need JavaScript enabled to view it.

 

АБСТРАКТ

Полимеразная цепная реакция (ПЦР) является многофункциональным инструментом в молекулярной биологии. Многочисленные модификации ПЦР оптимизированы под конкретные цели и стремятся достичь должной эффективности, специфичности и чувствительности. Несмотря на общий «классический» принцип, нет единой схемы оптимизации, учитывающей разнообразие применения ПЦР, по которой исследователь руководствовался бы в случае необходимости. Вместо этого у исследователя имеются данные ранее опубликованных авторов, представивших собственные схемы оптимизации ПЦР.

В данной статье мы описываем алгоритм оптимизации ПЦР протокола для выявления микроорганизмов на примере Pasteurella multocida, применяемый нами многократно и позволяющий достичь необходимую специфичность и чувствительность. Наша схема главным образом отличается от других применением индуктивного метода познания специфичности разрабатываемого протокола, использование ПЦР в режиме реального времени с применением SYBRGreenI для мониторинга амплификации в процессе оптимизации, а также простотой и доступностью в разработке и оптимизации диагностической ПЦР, применимой для широкого круга исследователей.

В результате были оптимизированы условия ПЦР для двух пар праймеров, тестированных на коллекции образцов ДНК, включающих 92 вида бактерий, 3 вида эукариотических организмов и обладающие чувствительностью к не ниже 5 копиям в геномном эквиваленте Pasteurella multocida.

Ключевые слова: ПЦР, оптимизация, Pasteurella multocida.


ВВЕДЕНИЕ

ПЦР является одним из самых часто используемых методов в молекулярной биологии, различные модификации которого базируются на общем принципе и насчитывают десятки областей применения.

Зависимость кинетики нуклеиновых полимеров от условий буферных систем [1] и природы её последовательности [2] были описаны ещё до открытия ПЦР. Применение различных полимераз открыло новые возможности ферментативной амплификации. Влияние концентрации солей и ионов не только на поведение молекул ДНК, но и на работу полимераз включило новые переменные в «уравнение» по поиску оптимальных условий амплификации. В связи с этим возникла проблема определения стратегии оптимизации, идея которой в итоге была заимствована из инженерной промышленности. Именно применение методов Тагучи является одним из первых методов планирования эксперимента по оптимизации ПЦР [3]. Методы Тагучи позволили одновременно выявлять эффекты и взаимодействия большого множества компонентов реакции, используя лишь ограниченное число проведенных экспериментов. На момент применения методов Тагучи в оптимизации ПЦР существовало большое количество экспериментальных методов проектирования, которые стали отправной точкой для разработки последующих схем оптимизации ПЦР[4].

Несмотря на существование стандартных и оптимальных условий, для конкретных ПЦР состав может варьировать. Учитывая широкое разнообразие применений и модификаций ПЦР, способы и алгоритмы определения оптимальных условий ПЦР до сих пор являются актуальной задачей. Несмотря на большое количество статей, посвященных стратегии оптимизации ПЦР с электрофоретической детекцией, среди них мало конкретных примеров, описывающих ситуативные особенности схем авторов.

Целью данной работы была оценка эффективности использования предложенного нами алгоритма оптимизации ПЦР протокола для выявления микроорганизмов на примере Pasteurella multocida.

Pasteurella multocida это грамотрицательная бактерия, являющаяся возбудителем пастереллёза (острое септицемическое заболевание, характеризующееся высокой смертностью, а также тяжелыми экономическими потерями) у крупного рогатого скота, овец, коз и домашней птицы [5]. Ежегодно причиной падежа домашних и в особенности диких животных Казахстана признаётся пастереллёз [6]. Диагноз у сельскохозяйственных животных базируется на клинических признаках, определении патологических изменений и бактериологических методах идентификации возбудителя. Эффективность этих методов не всегда соответствует современным требованиям ветеринарной диагностической практики, поэтому применение молекулярных методов является наиболее действующим способом контроля заболевания и снижения экономических потерь [7].

 

МАТЕРИАЛЫ И МЕТОДЫ

Дизайн праймеров

В работе мы использовали в качестве мишеней гены, находящиеся в непосредственной близости к рибосомальному оперону, так как по нашему опыту праймирование в данных регионах является наиболее эффективным.

Поиск последовательностей, гомологичных генам-мишеням, содержащим консенсусные мотивы, выполнялся с помощью веб-ресурса NCBI (https://www.ncbi.nlm.nih.gov/genome/), выравнивание последовательностей проводилось с использованием программного обеспечения BioEditSequenceAlignmentEditor 1997-2013 [8].

Дизайн праймеров и оценка вероятности образования вторичных структур (таких как шпильки и димеры) рассчитывались с применением программыPrimerSelect (DNASTAR).Специфичность праймеров, а также температура плавления была протестирована insilico с использованием веб-сервиса Primer-BLAST [9]. Спроектированные праймеры приведены в таблице 1.

 

Получение бактериальной ДНК

В экспериментах использовалась геномная ДНК изолятов P. multocida, выделенных из биоматериалов от сайгаков, находящихся в коллекции РГП на ПХВ «Национальный референтный центр по ветеринарии» КВКиН МСХ РК. Культивирование изолятов P. multocida проводили на мясо-пептонном агаре (HiMedia, Индия). ДНК выделяли с использованием набора реактивов «QIAamp DNA MiniKit» производства фирмы QIAGEN (США).

Для проверки специфичности протоколов была собрана коллекция образцов ДНК из 92 бактериальных видов микроорганизмов и 3 эукариотических многоклеточных видов организмов. Концентрацию ДНК определяли спектрофотометрическим методом с использованием спектрофотометра NanoDrop 1000 и флуориметра Qubit®. 2.0 Fluorometer с набором Qubit dsDNA HS Assay Kits.

Видовая принадлежность и контаминация бактериальных ДНК образцов была подтверждена анализом нуклеотидной последовательности 16SrRNA гена.

 

Проверка работоспособности праймеров

Проверку работоспособности проводили отдельно для каждой подобранной пары праймеров, с применением контрольной ДНК в концентрации 0,5 нг в реакции и отрицательным контролем (ТЕ буфер),эксперимент проводился в трех повторах. Реакционная смесь содержала 10 pmol прямого и обратного праймеров10 mM Tris-HCl (pH 8.8 при 25°C), 50 mM KCl, 0.08% (v/v) Nonidet P40, 2.5 mM MgCl2, 200 nM каждого dNTP, 1,25 Ед. Taq DNA полимеразы (Alphaferment, Russia). ПЦР выполнялась на термоциклере T-100 (Bio-Rad), программа включала первичную денатурацию 95°С–3 минуты; 42 цикла с денатурацией при 95°С – 30 секунд, отжиг праймеров при расчетной температуре в PrimerBlast 30 секунд, элонгация при 72°С в течение времени, необходимом для амплификации целевого фрагмента согласно инструкции производителя.

 

Оптимизация ПЦР

Оптимизацию ПЦР проводили по температуре отжига праймеров и концентрации ионов магния в реакционной смеси. При этом оптимизацию ионов магния проводили двухэтапно: 1 этап– грубый подбор концентрация магния в градиенте от 1,5 до 2,5 с шагом 0,5 mM; 2 этап – финальный подбор с концентрацией магния в диапазоне ±0,5 от оптимальной концентрации 1-го этапа оптимизации с шагом 0,2 mM. Реакционная смесь включала 10 pmol прямого и обратного праймеров 10 mM Tris-HCl (pH 8.8 при 25°C), 50 mM KCl, 0.08% (v/v) Nonidet P40, 200 nM каждого dNTP, 1,25Ед. Taq DNA полимеразы (Alphaferment, Russia), 5 нМ тетраметиламмония хлорида, 7%сахарозы, ксилен цианол 10 мг/мл, бетаин 0,2М. В качестве интеркалирующего красителя использовали SyberGreen I nunleic (Sigma, S9430) в 300 кратном разведении. Программа ПЦР включала первичную денатурацию при 95°С 3 минуты; 42 цикла с денатурацией при 95°С – 30 секунд, отжиг праймеров в градиенте температур от расчетной температуры в PrimerBlast ±4°С– 30 секунд, элонгация при 72°С в течение времени, необходимом для амплификации целевого фрагмента согласно инструкции производителя, и шаг учета флуоресценции при 75°С в течение 10 секунд. Амплификацию проводили на термоциклере CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Для каждой реакционной смеси использовали два ряда: первый ряд включал ДНК P. multocida в концентрации 0,05 нг в реакции, второй ряд ДНК E. сoliв концентрации 50 нг в реакции.

 

Оптимизация концентрации праймеров

Оптимизацию концентрации праймеров проводили, варьируя их соотношения в реакционной смеси в диапазоне от 200 до 600 nM с шагом 100 nM. С каждым соотношением ставили три повтора. Использовали оптимизированный состав реакционной смеси и программу амплификации с детекцией в режиме реального времениc SyberGreen I nunleic (Sigma, S9430).

 

Электрофорез

Электрофоретическое разделение продуктов амплификации проводили в 1,5% агарозе (ApplyChem A8963) и 1×ТАЕ буфере при V=90, mA=400, в камере Sub-Cell model 192, в качестве источника питания применялся Electrophoresis Power Supply – EPS 601.

 

Оценка специфичности

Оценка специфичности разрабатываемого протокола проводилась на 95 образцах ДНК, включая 92 ДНК бактерий и 3 ДНК высших эукариотических организмов, постановку ПЦР проводили по оптимизированным условиям реакции.

 

Оценка чувствительности

Оценку чувствительности проводили на контрольных образцах ДНК 4 изолятов P. multocida: P. multocida К-1 – выделенный от сайги, Pasteurella multocida 11–выделенный из печени 12-месячного бычка, Pasteurella multocida КТП №PS-1-2006– выделенный от лошади, Pasteurella multocida СП-95/2 – выделенная от курицы. Концентрацию ДНК доводили до 2 нг/мкл, используя набор Qubit dsDNA HS Assay Kit, при трехкратном подтверждении результата. Для каждого образца ДНК делали ряд двукратных разведений от 1,46 до 1,74*10-6 нг в мкл. Использовали в реакционной смеси 5 мкл, что в пересчете на количество копий соответствовало от 2,98 млн до 1 копий в реакции. Копийность рассчитывали с помощью интернет-ресурса [10]

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Оптимизацию ПЦР проводили, следуя предлагаемому нами алгоритму (рисунок 1).

Рис. 1.Схема оптимизации ПЦР
Fig. 1.PCR optimization scheme

 

Дизайн праймеров

Дизайн праймеров проводили к нуклеотидным последовательностям генов домашнего хозяйства: репликативной ДНКгеликазы субъединицы Бета (dnaB), АТФсинтазыс убъединицы B (atpB), ДНК-зависимой РНКполимеразы субъединицы Бета (rpoB) иДНК-зависимой РНКполимеразы субъединицы Бета’ (rpoB’). Для подбора праймеров было проведено выравнивание нуклеотидных последовательностей целевых генов, взятых из полногеномных данных78 штаммов, включающих: P. multocida–35, Pasteurella dagmatis – 1, Pasteurella pneumotropica – 3, Pasteurella bettyae – 1, Pasteurella skyensis–1, Pasteurella gallinarum – 1, Pasteurella caballi – 1,Pasteurella aerogenes – 1; Bibersteinia trehalosi – 5, Mannheimia haemolytica – 4, Actinobacillus pleuropneumoniae – 4, Actinobacillus minor – 2, Actinobacillus suis – 2, Actinobacillus equilisubsp. equili – 1, Actinobacillus ureae – 1, Actinobacillus succinogenes – 1, Aggregatibacter actinomycetemcomitans– 2, Haemophilus ducreyi – 2, Haemophilus parasuis – 2, Haemophilus haemolyticus – 2, Basfia succiniproducens – 1, Aggregatibacter aphrophilus – 2, Aggregatibacter segnis – 2, Mannheimia granulomatis – 1.

Выбор данных геномов был основан на генетической близости бактерий и наличия полногеномных последовательностей в базе данных [11]. Праймеры подбирались к консервативным участкам генов-мишеней участкам у Pasteurella multocida (рисунок 2), но гипервариабельным у близкородственных видов. Всего было подобрано 7 пар праймеров (таблица 1).

А – прямой праймер, Б – обратный праймер
Рис.2. Регион подбора праймеров к генам-мишеням на примере dnaBгена
A is the forward primer, B is the reverse primer
Fig. 2. Selection region of primers for target genes using dnaB gene as an example

 

Таблица 1. Список подобранных праймеров
Table 1.List of selected primers

Наименованиепраймера

 

The name of the primer

Последовательность, (5’-3’)

 

Thesequence, (5'- 3 ')

Ген

 

Gene

Размерампликона (bp)

 

The size of the amplicon (bp)

Расчетная температура отжига по ресурсу

 

PrimerBlast[12],°C

Estimated annealing temperature for PrimerBlast [12],°C

dnaB-Pmul-364-F  

ggatgaggcagaacgaaaag

dnaB

364

56,8

dnaB-Pmul-364-R  

acgcgataatgaagcaagaga

57,8

rpoB-Pmul-433-F  

gccatatccgtgctttaga

rpoB

433

54,7

rpoB-Pmul-433-R  

cctgtctcttcatcaatgcc

56,2

dnaB-Pmut-674-F  

gtctttgccatttcggag

dnaB

674

53,7

dnaB-Pmut-674-R 

cggtttaactgggataagg

52,7

rpoB-Pmut-435-5F 

cgccatatccgtgctttag

rpoB

435

56,2

rpoB-Pmut-435-14R 

acctgtctcttcatcaatgcc

58

dnaB-Pmut-410-9F 

cgcaaagctgttacacgaca

dnaB

410

59,4

dnaB-Pmut-410-6R 

acgcgataatgaagcaagaga

57,8

atpB-Pmut-622-2F 

cccaatttctgttccagtg

atpB

622

52,8

atpB-Pmut-622-1R 

tcttgcagaacacccatttc

56,2

dnaB_f-403  

atgtggcgcaaagctgttacac

dnaB

277

62,5

dnaB-r-680  

gggctgccacaatgatgagat

62,5

 

Оптимизация условий ПЦР реакции

Первоначальную проверку работоспособности праймеров целесообразно проводить с использованием наиболее часто описываемого состава реакционной смеси, 1×ПЦР буфер, ионы магния в концентрации 2,5 мМ, а также параметры циклирования, приведенные в наставлении к используемой полимеразе. В случае отсутствия амплификации следует перепроверить качество синтеза олигонуклеотидов [13] и повторить проверку работоспособности с понижением рамки температур на стадии отжига праймеров на ~ 8°С относительно расчетной или поставить градиент в данных температурных диапазонах. При первоначальной проверке работоспособности подобранных праймеров были амплифицированы ПЦР продукты ожидаемых размеров.

Дальнейший шаг оптимизации подразумевает определение точной температуры отжига праймеров и концентрацию ионов магния, при которых отмечается высокая эффективность и отсутствует неспецифический отжиг на отрицательный контроль, которым является геномная ДНК генетически близкого организма в высоких концентрациях (более 1 млн. копий в реакции). Электрофоретическая детекция не даёт данных об эффективности протекания реакции, поэтому оптимизацию лучше проводить с использованием SyberGreen в режиме реального времени. В качестве контроля неспецифического отжига мы использовали ДНК E.coli в концентрации 50 нг в реакции (что составляет 2.04*107копий), так как ДНК данного вида доступна в высоких концентрациях и он также входит в класс гамма протеобактерий[14]. Для этого проводится ПЦР в градиенте ±4°С от предсказанных температур плавления праймеров, и в концентрации ионов магния от 1,5 до 2,5 мМ с шагом 0,5 мМ.

На первом этапе оптимизации температуры отжига праймеров и концентрации ионов магния в диапазоне 1,5-2,5 мМ были исключены из дальнейшего анализа три пары праймеров: rpoB-435, dnaB-410, atpB-622, так как на электрофорезе были выявлены четко визуализированные дополнительные ПЦР продукты во всем диапазоне температур и всех концентраций магния (рисунок3).Для оставшихся четырех пар праймеров были выбраны оптимальные значения температуры отжига праймеров и концентрации магния, на основании максимальной эффективности ПЦР. В выбранных условиях был наименьший порог и максимальный уровень плато, а также отсутствовал отжиг на неспецифическую ДНК (E. coli) (рисунок 4).

Рис. 3. Оптимизация температуры отжига и концентрации ионов магния праймеров rpoB-Pmut-435
Fig. 3.Optimization of annealing temperature and magnesium ionconcentration of rpoB-Pmut-435 primers

 

Опираясь на оптимальную концентрацию магния, полученную на первом этапе оптимизации, был выполнен 2 этап, в диапазоне концентрации равной ±0,5 mM с шагом 0,2 мМ. Это позволило установить концентрацию, относительно которой изменения на 0,2 мМ не приводит к ухудшению эффективности (таблица 2). В результате был получен состав реакционной смеси, в котором потеря одного или нескольких компонентов в количестве ~10% не влияет на эффективность реакции. Это особенно полезно в тех случаях, когда ПЦР будет использоваться в условия диагностических лабораторий, где могут возникать систематические погрешности пепетирования [15].

Рис. 4. Оптимизация температуры отжига и концентрации ионов магния праймеров dnaB_f/r-403-680
Fig. 4. Optimization of annealing temperature and concentration of magnesium ions of primers dnaB_f/r-403-680

 

Повышение эффективности и чувствительности позволяют добиться использование присадок [16, 17, 18]. В данной работе мы решили использовать основной состав, предложенный нами ранее, включающий в себя 5 нМ тетраметиламмония хлорида, бетаин – до финальной концентрации 0,2М [19]. Включение сахарозы в последующем позволит использовать ПЦР продукт без смешивания с погрузочным буфером, что удобно в клинической практике. Оптимизация присадок подразумевает варьирование их в градиенте концентраций. При этом за одну постановку ПЦР целесообразно проводить оптимизацию одного компонента [20].

Так как ПЦР–это динамически напряжённая система, а динамика работы праймеров целиком зависит от энтальпийных и термодинамических характеристик молекулы, которые строго индивидуальны для разных олигонуклеотидов [21], то совершенно понятно, что динамика поведения праймеров в реакционной смеси различается. Таким образом, следующим шагом оптимизации является подбор динамически согласованного соотношения концентрации праймеров. Мы рекомендуем подбирать концентрацию праймеров от 200 нМ до 600 нМ прямого и обратного праймеров, а реакцию проводить в режиме реального времени с использованием интеркалирующего красителя SyberGreen. Приемлемым соотношением праймеров будет являться реакционная смесь, флюоресцентный сигнал которого будет начинаться раньше и уровень плато будет выше других. С каждым соотношением праймеров было поставлено 3 реакции, каждая из которых содержала ДНК Pasteurella multocida разных штаммов в концентрации 0,5 нг в реакции и отрицательный контроль – автоклавированная деионизированная вода. Варьирование соотношением праймеров позволило повысить эффективность ПЦР. В среднем значение цикла, на котором началась экспоненциальная фаза амплификации, уменьшилось на 1,3 цикла. Оптимальные значения для 4 пар праймеров приведены в таблице 2.

 

Таблица 2. Оптимизированные условия постановки ПЦР
Table 2. Optimized PCR conditions

Наименование праймеров

 

Name of primers

Оптимальная концентрация ионов магния

1-го этапа

 

Optimum concentration of magnesium ions of the 1st stage

Оптимальная концентрация ионов магния

 2-го этапа

 

Optimum concentration of magnesium ions of the 2nd stage

Оптимальная температура отжига

 

Optimal annealing temperature

Соотношение праймеров F/R (нМ)

 

The ratio of primers F / R (nM)

dnaB-Pmul-364

2,5 mM

2,4 mM

59°С

500/500

rpoB-Pmul-433

2,5 mM

2,4 mM

58°С

600/300

dnaB-Pmut-674

2,5 mM

2,6 mM

57°С

400/600

dnaB_f/r-403-680

2,5 mM

2,6 mM

60°С

400/600

 

Оценка специфичности и чувствительности ПЦР реакции

Специфичность разработанных протоколов проверяется на коллекции образцов ДНК максимального количества видов бактерий с концентрацией в реакции не менее 1 млн. копий. Наилучшим вариантом является включение в коллекцию образцов ДНК филогенетически близких микроорганизмов к возбудителю, для которого разрабатывается ПЦР. Также коллекция должна содержать образцы ДНК многоклеточных эукариотических организмов (восприимчивых к данному возбудителю). Необходимо включать в коллекцию микроорганизмы сапрофитной микрофлоры хозяев и ДНК возбудителей с идентичной симптоматикой, которые могут контаминировать образец или иным образом увеличить вероятность неспецифического отжига праймеров и получения ложноположительного результата.

Используемая нами коллекция образцов ДНК включала в себя 92 вида бактерий, идентифицированных по последовательности гена 16S rRNA. ДНК бактерий за исключением контрольного образца ДНК Pasteurella multocida бралась в концентрации от 5 до 50 нг в реакции, что соответствовало в геномном эквиваленте от восьми миллионов копий, а ДНК Esсherichia coli использовалась в концентрации 200 нг на реакцию, что составило в геномном эквиваленте более 33 миллионов копий в реакции.

К высшим эукариотическим многоклеточным организмам в коллекции относились образцы ДНК: курицы, овцы и крупного рогатого скота, ДНК которых также брали в  концентрации 200 нг на реакцию.

На данном этапе у пары праймеровdnaB-Pmul-364был выявлен неспецифический отжиг к видам: Bacillus licheniformis, Bacillus stratosphericus, Bacillus aryabhattai, Serratia proteamaculans, Rhodococcus opacus, Lactobacillus plantarum, Flavobacterium balustinum, Campylobacter rectus, Campylobacter upsaliensis, Campylobacter jejuni, Brucella suis, Bacillu samyloliquefaciens. А также у пары праймеров rpoB-Pmul-433 был выявлен неспецифический отжиг к видам: Devosianeptunia и Campylo bacterconcisus (таблица 3). Вследствие чего от этих пар отказались.

При апробации специфичности с праймерами dnaB-Pmut-674-F, dnaB-Pmut-674-R, dnaB_f-403 и dnaB-r-680 неспецифического отжига на геномную ДНК бактерий и многоклеточных животных выявлено не было.

 

Таблица 3. Специфичность праймеров
Table 3.Specificity of primers

Наименование вида

 

Name of species

Концентрация ДНК в реакционной смеси, нг

 

The concentration of DNA in the reaction mixture, ng

Наличие ПЦР амплификации с праймерами

 

The presence of PCR amplification with primers

dnaB-Pmul-364

rpoB-Pmul-433

dnaB-Pmul-674

dnaB_f/r-403

Acinetobacter johnsonii

50

No

No

No

No

Aeromonas bivalvium

50

No

No

No

No

Agrobacterium tumefaciens

5

No

No

No

No

Alcaligenes aquatilis

50

No

No

No

No

Arthrobacter polychromogenes

50

No

No

No

No

Bacillus amyloliquefaciens

5

Yes

No

No

No

Bacillus aryabhattai

50

Yes

No

No

No

Bacillus atrophaeus

5

No

No

No

No

Bacillus axarquiensis

50

No

No

No

No

Bacillus cereus

5

No

No

No

No

Bacillus licheniformis

50

Yes

No

No

No

Bacillus clausii

50

No

No

No

No

Bacillus mojavensis

5

No

No

No

No

Bacillus mucilaginosus

5

No

No

No

No

Bacillus mycoides

50

No

No

No

No

Bacillus pseudomycoides

5

No

No

No

No

Bacillus pumilus

5

No

No

No

No

Bacillus safensis

50

No

No

No

No

Bacillus simplex

5

No

No

No

No

Bacillus sonorensis

50

No

No

No

No

Bacillus stratosphericus

5

Yes

No

No

No

Bacillus subtilis

50

No

No

No

No

Bacillus tequilensis

50

No

No

No

No

Bacillus thuringiensis

5

No

No

No

No

Bovinae (КРС)

200

No

No

No

No

Brucella abortus

50

No

No

No

No

Brucella canis

50

No

No

No

No

Brucella melitensis

50

No

No

No

No

Brucella ovis

50

No

No

No

No

Brucella suis

50

Yes

No

No

No

Campilobacter gracilis

5

No

No

No

No

Campylobacter  concisus

5

No

Yes

No

No

Campylobacter coli

5

No

No

No

No

Campylobacter hyointestinalis

5

No

No

No

No

Campylobacter jejuni

5

Yes

No

No

No

Campylobacter mucosalis

5

No

No

No

No

Campylobacter rectus

5

Yes

No

No

No

Campylobacter showae

5

No

No

No

No

Campylobacter upsaliensis

5

Yes

No

No

No

Clostridium novyi

5

No

No

No

No

Delftia tsuruhatensis

5

No

No

No

No

Dermococcus nishinomiyaensis

5

No

No

No

No

Devosia neptunia

5

No

Yes

No

No

Ensifer adhaerens

5

No

No

No

No

Enterococcus durans

5

No

No

No

No

Erwinia amylovora

5

No

No

No

No

Esherichia coli

200

No

No

No

No

Exiguobacterium aurantiacum

5

No

No

No

No

Flavobacterium balustinum

50

Yes

No

No

No

Gallus domesticus

200

No

No

No

No

Halomonas nitritophilus

50

No

No

No

No

Klebsiella michiganensis

50

No

No

No

No

Klebsiella pneumoniae

5

No

No

No

No

Lactobacillus brevis

50

No

No

No

No

Lactobacillus casei

50

No

No

No

No

Lactobacillus garvieae

5

No

No

No

No

Lactobacillus paracasei

5

No

No

No

No

Lactobacillus plantarum

50

Yes

No

No

No

Lactobacillus pontis

5

No

No

No

No

Listeria innocua

5

No

No

No

No

Lysinibacillus boronitolerans

50

Yes

No

No

No

Lysinibacillus xylanilyticus

5

No

No

No

No

Microbacterium hydrocarbonoxydans

50

No

No

No

No

Ochrobactrum tritici

5

No

No

No

No

Ovis aries (Овечья)

200

No

No

No

No

P. multocida

5

Yes

Yes

Yes

Yes

Pedicoccus acidilactici

5

No

No

No

No

Pedicoccus pentosaceus

50

No

No

No

No

Pseudomonas chengduensis

50

No

No

No

No

Pseudomonas fluoresiens

50

No

No

No

No

Pseudomonas mandelii

5

No

No

No

No

Pseudomonas marginalis

5

No

No

No

No

Pseudomonas mucedolens

5

No

No

No

No

Pseudomonas plecoqlossicida

50

No

No

No

No

Pseudomonas putida

50

No

No

No

No

Pseudomonas reactans

50

No

No

No

No

Pseudomonas syringae

5

No

No

No

No

Rahnella aquaticus

50

No

No

No

No

Rhizobium agrobacterium

50

No

No

No

No

Rhizobium pusense

50

No

No

No

No

Rhodococcus jostii

50

No

No

No

No

Rhodococcus kroppenstedtii

5

No

No

No

No

Rhodococcus opacus

50

Yes

No

No

No

Rummeliibacillus pycnus

5

No

No

No

No

Salmonella enterica

5

No

No

No

No

Salmonella enteritidis

50

No

No

No

No

Serratia liquefaciens

50

No

No

No

No

Serratia plymuthica

50

No

No

No

No

Serratia proteamaculans

50

Yes

No

No

No

Sinorhizobium meliloti

5

No

No

No

No

Sphingomonas aerolata

5

No

No

No

No

Stenotrophomonas maltophilia

50

No

No

No

No

Stenotrophomonas maltophilia

5

No

No

No

No

Steptococcus salivarius

5

No

No

No

No

 

Дополнительно для праймеров с неспецифическим отжигом может быть использована оптимизация по температуре отжига праймеров и составу реакционной смеси с использованием в качестве отрицательного контроля ДНК организмов, на которых выявлен неспецифический отжиг. В нашем случае мы не проводили данный этап, так как в конечном итоге у нас было две пары специфичных праймеров.

Важной характеристикой разработанного ПЦР протокола является его чувствительность, оценку которой проводили только для специфичных праймеров. В эксперименте использовался метод двукратных разведений (таблица 4), начиная с максимальной имеющейся стоковой концентрации контрольной ДНК, равной 7,3 нг (что соответствует 2980 тыс. копий в геномном эквиваленте в реакции) до 1,74*10-6 нг (что соответствует 1 копии в геномном эквиваленте в реакции).

 

Таблица 4. Диапазон концентраций ДНК P. multocida при проверке чувствительности
Table 4. Range of P. multocida DNA concentrations in the sensitivity test

Лунка

 

Well

Количество ДНК в реакции, нг

 

The amount of DNA in the reaction, ng

Количество геномных копий в реакции

 

The number of genomic copies in the reaction

А1

7,3

2980000

В1

3,65

1490000

С1

1,825

745000

D1

0,9125

372500

E1

0,45625

186250

F1

0,228125

93125

G1

0,1140625

46562,5

H1

0,05703125

23281,25

А2

0,028515625

11640,625

В2

0,014257813

5820,3125

С2

0,007128906

2910,15625

D2

0,003564453

1455,078125

E2

0,001782227

727,5390625

F2

0,000891113

363,7695313

G2

0,000445557

181,8847656

H2

0,000222778

90,94238281

А3

0,000111389

45,47119141

В3

5,56946E-05

22,7355957

С3

2,78473E-05

11,36779785

D3

1,39236E-05

5,683898926

E3

6,96182E-06

2,841949463

F3

3,48091E-06

1,420974731

G3

1,74046E-06

0,710487366

H3

Отрицательный контроль

Отрицательный контроль

 

 Чувствительность для пар праймеров dnaB-Pmut-674-F- gtctttgccatttcggag, dnaB-Pmut-674-R- cggtttaactgggataagg и dnaB_f-403- atgtggcgcaaagctgttacac и dnaB-r-680- gggctgccacaatgatgagat была не ниже 5 копий или 13 фг в реакции (рисунок 5).

Рис. 5. Чувствительность ПЦР с праймерамиdnaB_f/r-403-680
Fig. 5.PCR sensitivity with primers dnaB_f / r-403-680

 

Чувствительность разработанных ПЦР протоколов превышает ранее предложенный протокол на toxA ген [22, 23] с детекцией в агарозном геле и не уступает коммерческим наборам, основанным на ПЦР с детекцией в режиме реального времени [24].

 

ЗАКЛЮЧЕНИЕ

Предложенный алгоритм позволяет поэтапно провести оптимизацию условий моноплексной ПЦР. Разработанные протокола ПЦР детекции Pasteurella multocida позволят с высокой степенью специфичности и чувствительности диагностировать пастереллёз у животных и птиц.

 

Финансирование

Работа выполнялась в рамках проекта «Разработка ПЦР тест-системы для выявления  Pasteurella multocida» в рамках реализации государственного заказа по научно-технической программе «Создание диагностических препаратов и вакцин на основе использования молекулярно-генетических методов для обеспечения ветеринарной безопасности».

 

REFERENCES

 

  1. Schildkraut C., Lifson S. Dependence of the Melting Temperature of DNA on Salt Concentration. Biopolymers., 1965, vol. 3, рр. 195-208.
  2. Freier S.M., Kierzek R., Jaeger J.A., SugimotoN., Caruthers M.H., Neilson T., TurnerD.H. Improved free-energy parameters for predictions of RNA duplex stability.Biochemistry Proc. Nati. Acad. Sci. USA, 1986,vol. 83, рр. 9373-9377.
  3. Cobb B.D., CIarkson J.M. A simple procedure for optimising the polymerase chain reaction (PCR) using modified Taguchi methods.Nucleic Acids Research., 1994,vol. 22, no. 18, pp. 3801-3805.
  4. Box G.E.P., W.G. Hunter and J.S. Hunter. Statistics for Experimenters. John Wiley &Sons.,1978.
  5. Prabhakar P., Thangavelu A., Prabhakar T.G., Kirubaharan J.J., Chandran N.D.J. Rapid virulence typing of P. multocida in sheep isolates of Tamil.Nadu. Indian J. Anim. Sci., 2012, vol. 82 (4), pp. 351-354.
  6. Nurushev M.Z., Kerimbay N.N., Baytanayev O.A., Kerimbay B.N. Actual problems of preservation of the saiga (saiga tatarica l.) in Kazakhstan. International journal of pure and applied zoology, 2019,vol. 4.2, pp.246-254.
  7. Rajeev-Gautam, Dutta T.K., Kumar A.A., Shivachandra S.B. Molecular typing of Indian isolates of P. multocida serogroup-A from different animal species. Indian J. Anim. Sci., 2006,vol. 76 (11), pp. 867-872.
  8. Hall T.A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.Nucl.Acids.Symp.Ser., 1999,vol. 41, pp. 95-98.
  9. US National Library of Medicine National Institutes of Health.
    link
  10. Calculator for determining the number of copies of a template.
    link
  11. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.Mol. Biol. Evol., 2011,vol. 28, pp. 2731-2739.
  12. Ye1 J., Coulouris G., Zaretskaya I., Cutcutache I., Rozen S. Madden T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction.BMC Bioinformatics., 2012, vol. 13, pp. 134.
  13. Domingues L. PCR: Methods and Protocols. Methods in Molecular Biology (Springer-Verlag., New York), 2017, 213 p.
  14. Bergeys Manual of Systematic Bacteriology, second edition. New York, Springer, 2005, vol. 2 (The Proteobacteria), part B (The Gammaproteobacteria).
  15. Sachse K., Frey J.PCR Detection of Microbial Pathogens: Methods and Protocols.Methods in Molecular Biology, Totowa, NJ, © Humana Press Inc., vol. 216.
  16. Pomp D., Medrano J.F. Organic solvents as facilitators of polymerase chain reaction.BioTechniques, 1991, vol. 10, pp. 58-59.
  17. Newton C.R., Graham A. PCR.Bios Scientific Publishers, Oxford, England, 1994.
  18. Susan Frackman, Gary Kobs, Dan Simpson, Doug Storts Betaine and DMSO: Enhancing Agents for PCR Promega Notes Number 65, 1998, pp. 27.
  19. Shevtsov A.B., Kairzhanova A.D., AbishevaG.D., Shevtsova E.S., Kamalova D.K., Dzhailbekova A.S., KaribaevT.B., Sytnik I.I., Ahmetova A.E., MukanovK.K. Development PCR test for specific identification C. coli, C. jejuni, C. fetus Eurasian. Journal of Applied Biotechnology, 2014, no. 3, pp. 59-65.
    CrossRef
  20. Kenneth H. Roux Optimization and Troubleshooting in PCR.PCR Methods and Applications., S186, Mannual Supplement.
  21. Breslauer K.J., Franks R., Blockers H., MarkyL.A. Predicting DNA duplex stability from the base sequence.Proc. Natl. Acad. Sci. USA,June 1986,vol. 83, pp. 3746-3750.
  22. Kamp E.M., Gertie C.A., Bokken M., Thea M.M. Vermeulen, Marten F. de Jong, Herma E., Buys C.M., Reek F.H., SmitsM.A. A specific and sensitive PCR assay suitable for large-scale detection of toxigenic Pasteurella multocida in nasal and tonsillar swabs specimens of pigs.J Vet Diagn Invest., 1996,vol. 8, pp. 304-309.
  23. Lichtensteiger C.A., Steenbergen S.M., LeeR.M., Polson D.D., VimrE.R. Direct PCR analysis for toxigenic Pasteurella multocida. J Clin Microbiol., Dec. 1996, vol. 34(12), рр. 3035-3039.
  24. 24.Methodical recommendation.
    link

 

МИКРОАҒЗАЛАРДЫ АНЫҚТАУҒА АРНАЛҒАН ПТР ХАТТАМАСЫН ОҢТАЙЛАНДЫРУ АЛГОРИТІМІ МЫСАЛЫ, Pasteurella multocida

 

Амиргазин А.О.1, Шведюк В.Б.1, Куйбагаров М.А. 1, Карибаев Т.Б.2, Шевцов А.Б.1
1Ұлттық биотехнология орталығы
Қорғалжын
тас жолы, 13/5, Астана, 010000, Қазақстан
2
Ветеринария бойынша ұлттық референттік орталық
Абайдың
150-жылдығына көшесі, 22/3 үй, Астана, 010000, Қазақстан

 

ТҮЙІН

Полимеразды тізбектік реакция молекулалық биологиядағы көп функциялы құрал болып табылады. ПТР-ның көптеген түрлендіруі нақты мақсат үшін оңтайландырылған және қажетті тиімділік, ерекшелік пен сезімталдылыққа қол жеткізуге ұмтылады. Жалпы «классикалық» принципке қарамастан, зерттеуші қажет болған жағдайда басшылыққа алатын ПТР қолданудың алуан түрлілігін есепке алатын бірыңғай оңтайландыру схемасы жоқ. Оның орнына зерттеушіде бұрын жарияланған авторлардың өздері ұсынғанПТР оңтайландыру схемасы бар.

Осы мақалада, өзіміз бірнеше рет пайдаланған және қажетті ерекшелік мен сезімталдыққа қол жеткізуге мүмкіндік беретін, микроорганизмдерді анықтауға арналаған ПТР хаттамасын оңтайландыру алгоритмі мысалы, Pasteurella multocida сипатталады.

Біздің схема ең бастысы басқалардан, әзірленген хаттаманың ерекшелігін танудың индуктивті әдісін қолдану арқылы, оңтайландыру кезінде амплификацияны бақылау үшін SYBRGreenI қолдану арқылы нақты уақыт тәртібіндегі ПТР пайдалануымен, сондай-ақ, зерттеушілердің кең ауқымында қолданылатын диагностикалық ПТР әзірлеу мен оңтайландырудағы қарапайымдылық пен қол жетімділігімен ерекшеленеді.

Нәтижесінде, бактериялардың 92 түрін және эукариотикалық ағзалардың 3 түрін қамтитын және геномдық эквивалентінде кемінде 5 көшірмесі бар сезімталдылыққа ие Pasteurella multocida ДНҚ үлгілерінің коллекциясына тестіленген екі жұп праймер үшін ПТР жағдайлары оңтайландырылды.

Негізгі сөздер: ПТР, оңтайландыру, Pasteurella multocida