3/2017
Zhumabek A.T., Zhylkibayev А.А., Kairzhanova А.D., Eskendirova S.Z., Manabayeva Sh.А., Shevtsov А.B.
National Center for Biotechnology
13/5, Korgalzhyn road, Astana, 010000, Kazakhstan
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

Chlamydia is a significant disease in animals and birds. Chlamydia results in important economic damage by causing the death of animals, pathology of reproductive organs, spontaneous abortion, and the bearing of dead offspring. The prevalence of chlamydia pathogens in nature among domestic and wild animals, including birds, presents a constant threat for people professionally engaged in agriculture. Great attention is paid to diagnosis when performing anti-epizootic activities associated with the prevention and elimination of chlamydia. According to the instructions of the World Organization for Animal Health (OIE), cell culture is the main diagnostic method for the identification of chlamydia causative agents. However, the duration and laboriousness of cell culture methods, along with the risk of staff infection, make laboratory diagnostics very difficult. In guidance to OIE diagnostic tests and vaccines prescribed the use of more than five modifications of PCR test systems for the diagnosis of chlamydia. A large proportion of animals with pathological Chlamydia have Chlamydia abortus. Here, we describe how we designed and synthesized a plasmid containing the conserved C. abortus outer membrane protein A (ompA) gene. After two-stage PCR synthesis, we obtained a 357bp long amplicon consisting of the C. abortus ompA gene flanked by BamHI and SacI restriction sites. The ompA gene was then cloned into thepUC57 plasmid, which was subsequently used to transform competent cells. Sequencing of transformant clones resulted in the identification and selection of a clone containing the ompA gene. The plasmid vector described here, containing the C. abortus ompA nucleotide sequence, can be used as a positive control in the development of PCR test systems for the diagnosis of animal chlamydiosis and for testing the sensitivity of PCR protocols.

Keywords: vector, ompA gene synthesis, animal chlamydia, Chlamydia abortus, PCR test system.


УДК 619:616-07; 619:579.62

 

 

СИНТЕЗ ГЕНА DE NOVO ОСНОВНОГОБЕЛКА ВНЕШНЕЙ МЕМБРАНЫ (ompA) Chlamydia abortus

 

Жұмабек А.Т., Жылкибаев А.А., Каиржанова А.Д., Ескендирова С.З., Шевцов А.Б., Манабаева Ш.А.
Национальный центр биотехнологии
Кургальжинское шоссе, 13/5, Астана, 010000, Казахстан
manabayeva
@biocenter.kz

 

АБСТРАКТ

В структуре инфекционной патологии сельскохозяйственных животных и птиц значительное место занимает хламидиоз. Заболевание наносит существенный экономический ущерб, вызывая гибель животных, патологию воспроизводительных органов, аборты, рождение мертвого приплода. Распространенность возбудителей хламидиозов в природе среди домашних и диких животных, а также птиц представляет постоянную угрозу спорадических заболеваний для людей, профессионально занятых в сельском хозяйстве. При выполнении противоэпизоотических мероприятий, связанных с профилактикой и ликвидацией хламидиоза, большое внимание уделяется диагностике. Согласно руководству Международного Бюро (МЭБ), идентификация возбудителя хламидиоза в культуре клеток является основным достоверным методом диагностики. Однако длительность и трудоемкость культурального метода диагностики, а также риск инфицирования персонала существенно затрудняют его использование в лабораторной диагностике. В руководстве по диагностическим тестам и вакцинам МЭБ предписано использование более 5 модификации ПЦР тест-систем для диагностики хламидиоза.

Нами осуществлен дизайн и de novo синтез гена ompA Chlamydia abortus ввиду большого удельного весах хламидийных патологий животных. В результате двухэтапного химического синтеза с помощью ПЦР получен ген ompA Chlamydia abortus длиной 357 пар нуклеотидов, содержащий сайты рестрикции BamHI и SacI. Консервативный ген внешнего мембранного белка ompA клонирован в плазмиду pUC57. В результате секвенирования ДНК клонов-трансформантов выбран клон с правильной нуклеотидной последовательностью целевого гена. Полученный плазмидный вектор с фрагментом нуклеотидной последовательности гена ompA Chlamydia abortusиспользован в качестве позитивного контроля при разработке ПЦР тест-системы для диагностики хламидиоза животных и проверки чувствительности ПЦР протоколов.

Ключевые слова: вектор, синтез гена ompA, хламидиоз животных, Chlamydia abortus, ПЦР тест-системы.


ВВЕДЕНИЕ

Хламидийные инфекции (хламидиозы) – группа инфекционных болезней, распространенных во всем мире, и занимающих большой удельный вес в инфекционных патологиях животных, особенно в странах с развитым животноводством [1]. Хламидийные инфекции зарегистрированы по всему миру и поражают более 20 видов млекопитающих, а также 465 видов птиц [2]. Заболевание наносит существенный экономический ущерб, вызывая гибель животных, патологию воспроизводительных органов, аборты, рождение мертвого приплода.

При выполнении противоэпизоотических мероприятий, связанных с профилактикой и ликвидацией хламидиоза, большое внимание уделяется диагностике. Длительное бессимптомное течение и нехарактерные клинические проявления затрудняют клиническую диагностику хламидиоза животных. Недостаточно эффективны серологические методы анализа, так как заболевание протекает в латентной форме, часто вызывая слабый иммунный ответ организма. Согласно руководству Международного эпизоотического Бюро (МЭБ), идентификация возбудителя хламидиоза в культуре клеток является основным достоверным методом диагностики (http://www.oie.int.). Однако длительность и трудоемкость культурального метода диагностики, а также риск инфицирования персонала существенно затрудняют его использование в лабораторной диагностике.

Хламидии – грамотрицательные, облигатные внутриклеточные бактерии. Таксономия хламидий претерпела многочисленные изменения на протяжении прошлого столетия. С внедрением молекулярно генетических методов в основу таксономии бактерий стало ясно, что разнообразие хламидий значительно шире и в 2009 было предложено воссоединить рода в одни с общим названием Chlamydia, который должен включать в себя девять видов: Chlamydia trachomatis, Chlamydia muridarum, Chlamydia pneumoniae, Chlamydophila pecorum, Chlamydiasuis, Chlamydophila abortus, Chlamydophila felis, Chlamydiacaviae и Chlamydophilapsittaci [3,4]. Все виды характеризуются различием в хозяинах, тропизме и клиническом проявлении болезней.

Большой удельный вес в патологиях животных и птиц имеют C. abortus и C. psittaci. C. abortus, этиологический агент энзоотического аборта овец, характеризуется воспалением плодных оболочек, особенно в котиледонах, и проявляющаяся абортами во второй половине суягности или рождением слаборазвитого, нежизнеспособного молодняка [5]. Помимо овец, C. abortus инфицирует крупный рогатый скот, свиней и лошадей, а также может инфицировать человека, преимущественно беременных женщин, локализуясь в плаценте и приводя к абортам и преждевременным родам [6]. Овцеводческим хозяйствам инфекция может приносить огромные убытки, связанные с абортированием животных на последних неделях. При этом в первый год инфицирования стада количество абортов сводится к единичным случаям, однако во второй год эта цифра может достичь 30% [7].

Согласно рекомендациям МЭБ, наряду с культуральным методом выявления и дифференциации хламидий, могут использоваться молекулярно-генетические методы –полимеразно-цепная реакция (ПЦР), которая имеет преимущество ввиду высокой чувствительности, специфичности, возможности прямого определения фрагмента генома возбудителя и быстроты проведения исследования. В руководстве по диагностическим тестам и вакцинам МЭБ предписано использование более 5 модификаций ПЦР тест-систем для диагностики хламидиоза (http://www.oie.int.).

В настоящее время на мировом рынке имеются ПЦР тест-системы для диагностики хламидиоза животных от зарубежных производителей, примерная стоимость которых в Республике Казахстан составляет около 200 тыс. тенге. В странах ближнего зарубежья, в частности, в России, выпускается ПЦР тест-система для выявления толькоChlamydia psittaci, ориентированная на птицеводство ("АмплиСенс") [8]. Применение ПЦР в диагностике хламидиоза животных и птиц в ветеринарных лабораториях РК затруднительно из-за высокой цены тест-систем дальнего зарубежья и недостаточности охвата клинически значимых видов хламидий. Необходимо отметить, что в Казахстане отсутствуют отечественные ПЦР тест-системы для диагностики хламидиоза животных.

Поэтому разработка отечественных тест-систем для диагностики хламидиоза животных и птиц является актуальной задачей.

 

МАТЕРИАЛЫ И МЕТОДЫ

Дизайн целевого гена ompAChlamydia abortusвыполнен с использованием пакета программ Vector NTI 11.5 (Invitrogen, США). Для denovo синтеза гена ompA праймеры делили на две группы – «внутренние» и «фланкирующие». При этом чередование «внутренних» праймеров происходило в порядке «Прямой – Обратный – Прямой – Обратный» и т.д.Соединяемые друг с другом праймеры имели область перекрывания не менее 15 нуклеотидов. Смесь «внутренних» праймеров использовали на I-м раунде ПЦР, полученный ПЦР продукт использовали во II-м раунде ПЦР–амплификации с парой «фланкирующих» праймеров. При проведении ПЦР использовалась высокоточная полимераза «PhusionHotStart II HighFidelity» (ThermoScientific, США).Программа denovo синтеза гена ompAвключала длительную денатурацию 95°С в течение 5 минут; 30 циклов: 95°С – 30 секунд, 55°С – 45 секунд, 72°С – 1 минута ; заключительная элонгация 10 минут при 72°С, ПЦР программа была выполнена с применением амплификатораT-100 ThermalCycler(Bio-Rad).

Клонирование синтезированных denovo фрагментов ДНК, содержащих целевой ген, проводили как описано в лабораторном руководстве [9]. Подтверждение правильности сборки гена в синтезе denovo проводили путём определения нуклеотидной последовательности ДНК клонированных фрагментов. Секвенирование проводили с использованием наборов BigDye 3.1 на автоматическом секвенаторе DNAAnalyzer 3730 xl (AppliedBiosystems, США).

Трансформация клеток E.coli плазмидной ДНК была проведена методом температурного шока. Для клонирования использовали штамм Escherichia coli XL-Blue, питательную среду Luria-Bertani (LB) с соответствующими антибиотиками. Электрофоретическое разделение нуклеиновых кислот проводили в 1% агарозном геле в буфере ТАЕ при напряжении 120 В, время 45 минут. Окрашивание в этидиум бромиде из расчета 15 мкг на 100 мл геля. Детекция осуществлялась при ультрафиолетовом излучении при длине волны 312 нм.

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЯ

Клонирование генов является методом, широко используемым в молекулярной биологии. Тем не менее, амплифицирование ДНК с помощью ПЦР обычно требует присутствия матричной ДНК, которая не всегда доступна. Поэтому целевой синтез генов становится предпочтительным методом применения. Основной вклад в развитие олигонуклеотидного синтеза внес Г. Корана, осуществивший в начале 60-х годов химический синтез фрагментов нуклеиновых кислот заданной последовательности и получивший за эту работу в 1968 году Нобелевскую премию. В 1970 году он впервые синтезировал полный ген аланиновой транспортной РНК [10].

В настоящее время достаточно быстро можно синтезировать искусственные фрагменты нуклеиновых кислот разной длины и любого состава, а затем соединить их в более длинные цепи с помощью специальных ферментов. Полученные таким образом гены и их фрагменты широко используются в генетической инженерии, биотехнологии, а также для диагностики инфекционных и генетических заболеваний.

В рамках данного исследования, с целью выбора генетических маркеров для подбора праймеров, позволяющих выявлять и проводить видовую идентификацию C. abortus, проведен информационный анализ литературных источников, а также анализ геномов различных видов Chlamydia spp. На основании литературных данных и анализа генома в качестве мишени, пригодной для ПЦР тест-системы, выбран ген ompA.Нуклеотидная последовательность гена имеет консервативные участки между видами C. abortus, которые вариабельны у остальных видов хламидий. С целью подбора праймеров к нуклеотидной последовательности ompA гена и выбора региона для клонирования из международной базы данных NCBI (http://www.ncbi.nlm.nih.gov/) были взяты последовательности ompAгена 9 видов хламидий в общей численности 65.

Нуклеотидная последовательность гена ompA проанализирована с помощью компьютерной программы Vector NTI 11.5 (рисунок 1). Выбран участок ДНК, подходящий для подбора праймеров.

Рис. 1.Фрагмент нуклеотидной последовательности гена ompA Chlamydia abortus
Fig. 1. Fragment of the nucleotide sequence of the Chlamydia abortus ompA gene 

 

Далее проведен дизайн олигонуклеотидов для получения нуклеотидной последовательности гена ompA Chlamydia abortusde novo. Для синтеза фрагмента последовательностей ДНК, кодирующих ген ompA Chlamydia abortus,использовали праймеры, перечисленные в таблице 1.

Таблица 1.Олигонуклеотиды для синтеза de novo фрагмента гена, кодирующиеompA Chlamydia abortus
Table 1.Primersequences designedfor the synthesis ofompA Chlamydia abortus

Код

Последовательность (5’->3’)

ompA/F-1

gcatggatcctcctaaagtcgcacaaccacactcccataaagctccgcgtgcacctacac

ompA/R-2

ggaatcgttgaattttatacagatacaacattctcttggagtgtaggtgcacgcggagct

ompA/F-3

gtataaaattcaacgattccttgagtgatgcctacattgggaagctgatcagctgctatg

ompA/R-4

cattcaacctcgttggtttgattggtgttaaaggatgctccatagcagctgatcagcttc

ompA/F-5

caaaccaacgaggttgaatgccgcagaactagctttgaagtacccattagaagcgcctaa

ompA/R-6

cgcattgaatatctgggatcgctttgatattttctgcacattaggcgcttctaatgggta

ompA/F-7

gatcccagatattcaatgcgaggaaagctgcattggtgaaccattcggcgtcttgtaagt

ompA/R-8

aaaactcctacggatagacccaacatcgcttacggcaaacacttacaagacgccgaatgg

ompA/F-9

ggtctatccgtaggagttttgtaattagctgctgcggttcctgtagggagctccagtc

ompA/F-10

gcatggatcctcctaaagtc

ompA/R-11

gactggagctccctacagga

 

Фрагмент ДНК, кодирующийompA Chlamydia abortus, состоящий из 357 пар нуклеотидов, был синтезирован denovo в результате двухраундового ПЦР метода. На первом раунде проводили амплификацию со смесью девяти внутренних праймеров от ompA/F-1 до ompA/F-9. Продукты первого раунда были использованы в качестве матрицы для амплификации в ПЦР второго раунда с парой фланкирующих праймеров ompA/F-10иompA/R-11.В результате двухэтапного химического синтеза с помощью ПЦР получен ген ompA Chlamydia abortus,содержащий сайты рестрикции BamHI иSacI. Результаты ПЦР второго раунда представлены на рисунке 2.

Дорожки (слева направо): М – маркёр длин фрагментов ДНК O’GeneRuler 1kb DNALadder (Fermentas); 1-5 –фрагмент ДНК, несущий фрагмент гена ompA Chlamydophila abortusс линкерами для клонирования
Рис. 2.Электрофореграммапродуктов ПЦР реакции синтеза гена ompA Chlamydia abortusиз олигонуклеотидов
Lanes (from left to right): M – DNA ladder (O'GeneRuler 1kb, Fermentas), 1-5 –DNA fragment carrying a fragment of Chlamydophila abortus ompA gene with cloning linkers
Fig. 2. Electrophoretic data of PCR products from synthesized oligonucleotides of the Chlamydia abortus ompA gene

 

В процесс молекулярного клонирования (избирательного накопления) молекул ДНК входит несколько этапов: фрагментация ДНК путем обработки эндонуклеазой рестрикции, объединение этих фрагментов in vitro с векторной молекулой ДНК (способной к автономной репликации), введение вектора в реципиентный организм, в котором и происходит накопление рекомбинантных ДНК. Для клонирования в качестве векторной молекулы использовали плазмидный вектор pUC57, который обрабатывали рестриктазами BamHI и SacI в присутствии фосфатазы SAP. Подготовленный вектор был смешан со вставкой и обработан лигазой, после чего лигазную смесь трансформировали в компетентные клетки XL-Blue. Трансформированные клетки высевали на агаризованную среду с добавлением антибиотика ампициллина (100 мг/л). Из выросших клонов-трансформантов были выбраны 5 клонов, которые использовали для выделения ДНК. Плазмидная ДНК этих клонов была анализирована с помощью ПЦР на наличие гена ompA.Программа ПЦР амплификации включала денатурацию 94°С в течение 5 минут; 30 циклов: 94°С – 30 секунд, 55°С–20 секунд, 72°С – 30 секунд; заключительная элонгация 10 минут при 72°С.

Таким образом,был получен рекомбинантный плазмидный вектор pUC/ompA, несущий вставку целевого фрагмента гена ompA(рисунок 3). С помощью секвенирования ДНК отобранных клонов был выбран клон, в котором последовательности целевого гена имели правильную структуру, который планируется применить в качестве контроля в дальнейших исследованиях.

Рис. 3. Рекомбинантный плазмидный векторpUC/ompAс фрагментом гена ompA Сhlamydia abortus
Fig. 3. Recombinant plasmid vector pUC/ompA with a fragment of the Chlamydia abortus ompA gene

 

ВЫВОДЫ

В результате проведенных молекулярно-генетических работ был получен плазмидный вектор с фрагментом нуклеотидной последовательности генаompA Chlamydia abortus. Планируется использование данного векторав качестве позитивного контроля при разработке ПЦР тест-систем для выявления хламидиоза животных.

 

Финансирование

Данная работа была выполнена при финансовой поддержке Министерства образования и науки Республики Казахстан в рамках научного проекта №0115РК01869 на 2015-2017годы.

 

REFERENCES

 

  1. Kritas S.K., Saoulidis K., Tsinas A., Papadopoulos O., Kyriakis S.K. Chlamydial infections in swine industry and their significance.Bulletin of the Hellenic Veterinary Medical Society.,1998, vol.49, no. 1, pp.11-15.
  2. Kaleta E.F., Taday E.M. Avian host range of Chlamydophilaspp. based on isolation, antigen detection and serology.Avian Pathol., 2003,vol. 32, pp. 435-462.
  3. Greub G. International Committee on Systematics of Prokaryotes. Subcommittee on the taxonomy of the Chlamydiae: minutes of the inaugural closed meeting.In: Int. J. Syst. Evol. Microbiol.,2010,vol.60, pp.2691-2694.
  4. Schachter J., Stephens R.S., Timms P., et al. Radical changes to chlamydial taxonomy are not necessary just yet.In: Int. J. Syst. Evol. Microbiol., 2001, vol.51,no.249, pp.243-251.
  5. Ivanov N.P., Turginbaev K.A., Kozhaev A.N.Boleznizhvachnyhzhivotnyh, svinejiloshadej(Diseases of ruminants, pigs and horses).Almaty, 2012,vol. 3,319 p.
  6. Hyde S.R., Benirschke K. Gestational psittacosis: case report and literature review.Mod.Pathol.,1997, vol. 10, pp.602-607.
  7. Longbottom D., Coulter L.J. Animal chlamydioses and zoonotic implications.J. Comp. Pathol.,2003, vol. 128, pp.217-244.
  8. Obuhov I.L. Vasil'ev D.A. Hlamidioz [Chlamydia], Ul'janovsk, 2003.135 p.
  9. Sambrook J., Fritsch E.F., Maniatis T. Molecular cloning: a laboratory manual.Cold Spring Harbor Laboratory Press., 1987, pp. 969.
  10. Caruthers M., Wells R. HarGobind Khorana (1922-2011)Science, 2011, no.334, pp.1511.
    CrossRef PubMed

Chlamydia abortus СЫРТҚЫ МЕМБРАНАСЫНЫҢ НЕГІЗГІ АҚУЫЗЫНЫҢ (ompA) ГЕНІН DE NOVO СИНТЕЗДЕУ

 

Жұмабек А.Т., Жылқыбаев А.А., Қайыржанова А.Д., Ескендірова С.З., Шевцов А.Б, Манабаева Ш.А.
Ұлттық биотехнология орталығы
Қорғалжын тас жолы 13/5, Астана, 010000, Казахстан
manabayeva
@biocenter.kz

 

ТҮЙІН

Аулшаруашылық жануарлардың жұқпалы патологиялары құрылымында хламидиоз айтарлықтай орын алады.Ауру жануарлардың өліміне, ұрықтану органдарының патологиясына, түсік тастауға, өлі ұрпақтардың туылуына алып келетін елеулі экономикалық шығындар тудырады.Үй және жабайы жануарлардың, сондай-ақ құстардың арасында хламидиоз патогендерінің таралуы ауыл шаруашылығында кәсіпқой айналысатын адамдар үшін үнемі жұқтыру қауіпін тудырады. Хламидиоздың алдын алу және жоюға байланысты эпизоотияға қарсы іс-шараларды жүргізу барысында балауға көп көңіл бөлінеді. Халықаралық бюро (OIE) деректемесіне сәйкес жасушалық культурада хламидиоздың қоздырғышын анықтау әдісі сенімді диагностикалық құрал болып табылады. Бірақ, диагностиканың культуралды әдісінің ұзақтығы мен қиындығы, сондай-ақ қызметкерлерді жұқтыру қауіпі оны зертханалық диагностикада қолдануды ауырлатады.OIE ұсынымдарына сәйкес хламидиозды анықтау және ажырату үшін культуралды әдіспен қатар молекулярлы-генетикалық әдістерді – полимеразды тізбекті реакция (ПТР) қолдануға болады. Ұйымның диагностикалық сынақтар мен вакциналарға арналған нұсқаулығында хламидиозды балау үшін ПТР сынау жүйесінің 5-тен астам модификацияларын пайдалану белгіленген. Берілген зерттеуде Chlamydia abortus-тың ompA генінің de novo синтезі және дизайны жасалды. Екі кезеңді химиялық синтез нәтижесінде ПТР арқылы, құрамында BamHI және SacI рестрикциялық сайттары бар ұзындығы 357 жұп нуклеотидті құрайтын Chlamydia abortus ompA гені алынды. ОmpA сыртқы мембрана ақуызының консервативті гені pUC57 плазмидасына клондалды. Трансформант клондарының ДНҚ секвенирлеу нәтижесінде арнаулы геннің дұрыс реттігі бар клон таңдалды. Алынған плазмидалы вектор Chlamydia abortus ompA генінің реттілігі бар нуклеотидті фрагмент жануарлардың хламидиозын балаудағы ПТР тест-жүйесін өңдеу кезіндегі позитивті бақылау ретінде және ПТР хаттамаларының сезімталдығын тексеруде қолданылуы мүмкін.

Негізгі сөздер: геном, вектор, ОmpA ген синтезі, жануарлар хламидиозы,Chlamydia abortus, ПTP тест-жүйесі.