3/2016

 

УДК 577.21; 602.68:57.083

 

ПОЛУЧЕНИЕ РЕКОМБИНАНТНЫХ 2С, 3А, 3В И 3D НЕСТРУКТУРНЫХ БЕЛКОВ ВИРУСА ЯЩУРА

 

Мукантаев К.Н., Шустов А.В., Турсунов К.А., Інірбай Б., Әдіш Ж., Раманкулов Е.М., Муканов К.К.
Национальный центр биотехнологии
Кургальжинское шоссе, 13/5, Астана, 010000, Казахстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

АБСТРАКТ

Ящур – высоко контагиозная инфекционная болезнь сельскохозяйственных и диких парнокопытных животных. Основным и эффективным способом предупреждения возникновения и распространения инфекции является вакцинация восприимчивого поголовья и создание буферной зоны из иммунизированных животных. В связи с этим выявление больных ящуром животных среди вакцинированного поголовья имеет большое значение в профилактике инфекции. В работе представлены материалы по получению рекомбинантных 2C, 3A, 3B и 3D неструктурных белков вируса ящура, определению их диагностических характеристик в иммуноферментном анализе. Основываясь на анализе аминокислотной последовательности 2С, 3А, 3В и 3D неструктурных белков различных типов вируса ящура, были выбраны гены наиболее консервативных и иммуногенных участков антигенов. Проведены дизайны генетических конструкций несущих гены 2С, 3А, 3В и 3D неструктурных антигенов вируса ящура. В качестве экспрессионных плазмид использованы pET32 и рЕТ28 вектора.

В результате проведенных исследований получены рекомбинантные 2С, 3А, 3В и 3D неструктурные антигены, предназначенные для использования в иммуноферментном анализе. Молекулярная масса 2С, 3А, 3В и 3D неструктурных антигенов составила 40, 45, 38 и 34 кДа, соответственно.

Ключевые слова: биотехнология, вирусы, иммуноферментный анализ, ящур, антиген, неструктурный антиген.


ВВЕДЕНИЕ

Ящур – высоко контагиозная инфекционная болезнь сельскохозяйственных и диких парнокопытных животных. Биологические, физико-химические характеристики вируса, а также широкий спектр восприимчивых животных обеспечили широкое распространение ящура во всем мире. Возникновение болезни причиняет значительный экономический ущерб экономике страны. Экономический ущерб связан с проведением карантинных мероприятий (полное уничтожение всего поголовья сельскохозяйственных животных в очаге заболевания) и длительными ограничительными мероприятиями при реализации сельскохозяйственной продукции.

Основным и эффективным способом профилактики распространения болезни является вакцинация восприимчивого поголовья и создание буферной зоны из иммунизированных животных. В Республике принята программа по созданию буферной зоны, включающая Восточно-Казахстанскую, Южно-Казахстанскую, Алматинскую, Жамбылскую и Кызылординскую области. По данным ряда авторов, данные области отнесены к зоне с высокой степенью риска возникновения заболевания [1, 2]. Данная стратегия привела к положительным результатам и на период 2014-2015 годы в Республике не отмечены случаи возникновения болезни.

Немаловажную роль сыграли диагностические исследования на антитела, специфичные к неструктурным антигенам вируса ящура. В настоящее время в Республике используются иммуноферментные тест-системы различных производителей, таких как Svanova (SVANOVIR® FMDV 3ABC-Ab ruminant), Priochek (PrioCHECK® FMDV NS Antibody ELISA Kit) и т.д. Используемые диагностические тест-системы основаны на комплексном 3АВС антигене. Гипотеза, что антитела против 3ABC антигена в сыворотке животных являются убедительным доказательством репликации вируса, была подтверждена в 1997 году M. De Diego. По данным автора, все сыворотки от инфицированных животных дали положительные результаты в ELISA-3ABC, независимо от серотипа ящура. В противоположность этому более 99% сывороток вакцинированных животных были отрицательными [3].

Подтверждающие результаты получили при сравнительном анализе трех коммерческих наборов, проведенных Moonen P. с соавторами в 2004 году. Один из наборов основан на использовании 3АВС полипротеина, второй – на основе нативных антигенов, выделенных из культуры клеток, и третий – на синтетическом 3В неструктурном антигене [4]. Авторы определили, что при установлении базовой линии для каждого набора индивидуально лучшие результаты по специфичности и чувствительности показали тест-системы, основанные на 3АВС и 3В неструктурных антигенах.

Вместе с тем, использование вакцин без глубокой очистки могут приводить к появлению у вакцинированных животных антител к неструктурным антигенам. С такой проблемой столкнулись ветеринарные службы нашей Республики. В результате этого трудно было однозначно отнести указанных животных к группе здоровых или реконвалесцентов. С похожей проблемой столкнулись и в ряде стран Южной Америки. Выходом из проблемы стало использование разновидности иммуноблота на основе отдельных неструктурных белков (NSP-based enzyme linked immunoelectrotransfer blot, NSP-EITB). Диагностические характеристики данной тест-системы по чувствительности и специфичности не уступали традиционным коммерческим препаратам [5].

В данной работе представлены результаты по получению рекомбинантных 2C, 3A, 3B и 3D неструктурных белков вируса ящура и определению их диагностических характеристик в иммуноферментном анализе.

 

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы микроорганизмов, плазмиды, питательные среды, олигонуклеотиды

В работе использовались штаммы Е. coli  DH5α и BL21 (DE3), плазмидные вектора pGEM-TEasy, pET32, pET28 и Е8.рЕТ32_2C3AB. Клетки E. coli выращивали на жидкой и плотной питательной среде LB с добавлением ампициллина.

Для получения кодон оптимизированных генов 3B, 3D и 2С неструктурных антигенов вируса ящура синтезированы взаимно перекрывающиеся олигонуклеотиды. Для синтеза гена 3А антигена были синтезированы следующие праймеры: 3Astart – CCGGGCATTTTGGAGAAA; 3Astop – ATCATCGCTTGCCTTGTGCCC; 3Аstartrest – GGATCCCCATGGGCCCGGGCATTTTGGAGAAA; 3Astoprest – AAGCTTCTCGAGTTAATGATGATGATGATGGTGATCATCGCTTGCCTTGTGCCC.

 

Получение генетических конструкций, несущих гены 2С, 3А, 3В и 3D неструктурных антигенов вируса ящура

Синтез генов 3В, 3D и 2С неструктурных антигенов вируса ящура с 4 концевыми сайтами рестрикции проводился в условиях de novo полимеразной цепной реакции с использованием Phusion полимеразы. Синтез генов 3А антигена вируса осуществляли полимеразной цепной реакцией поэтапно. Первый синтез осуществляли с помощью праймеров 3Astart – CCGGGCATTTTGGAGAAA; 3Astop – ATCATCGCTTGCCTTGTGCCC. Для получения генов с концевыми сайтами рестрикции использовали праймеры 3Аstartrest – GGATCCCCATGGGCCCGGGCATTTTGGAGAAA; 3Astoprest – AAGCTTCTCGAGTTAATGATGATGATGATGGTGATCATCGCTTGCCTTGTGC.

Разделение фрагментов ДНК проводили согласно Маниатису и др. [6] методом горизонтального электрофореза в 1% агарозном геле. Препаративное разделение фрагментов ДНК проводили в 0,8% в легкоплавком агарозном геле. Фрагмент ДНК экстрагировали смесью фенол-хлороформ и хлороформом, после чего преципитировали этанолом.

Для лигирования фрагментов ДНК использовали ДНК-лигазу фага Т4. Гидролиз плазмидной ДНК проводили с использованием эндонуклеаз рестрикции NcoI и XhoI в соответствующих буферных и температурных условиях согласно рекомендациям производителей.

Трансформацию клеток лабораторных штаммов E. coli DH5cc и XLBlue проводили по методу Hanahan [7]. Первичную структуру ДНК определяли по методу Sanger [8] с использованием наборов BigDye на автоматических анализаторах ДНК ABI Prism 3100 (Applied Biosystems, США).

 

Очистка рекомбинантных неструктурных белков вируса ящура

Клетки продуценты выращивали в 200 мл среды LB до OD600 ~ 0.8 при 37оC в течение 18-24 часов. По достижении необходимой плотности добавляли 0,5 мМ IPTG и культивировали в течение 8 часов при комнатной температуре. После этого клетки осаждали центрифугированием при 3000 g в течение 20 минут, осадок промывали в 1/3 объемах физиологического раствора, центрифугировали при 3000 g течение 20 минут и ресуспендировали в 10 мл TNE буфера (20 мМ Трис рН 7.5, 1 мМ ЭДТА, 100 мМ NaCl). Клетки разрушали ультразвуком (22 kHz, 4 раза по 120 секунд), нерастворимую фракцию отделяли центрифугированием при 13000 об/мин в течение 60 минут. Нерастворимую фракцию (осадок) ресуспендировали в 10 мл буфер №1 (20 мМ HEPES, 500 mM NaCl, 1 М мочевиной), инкубировали 30 минут на орбитальном шейкере при комнатной температуре, затем центрифугировали при 13000 об/мин в течение 30 минут. Нерастворимую фракцию ресуспендировали в буфере для металл-аффинной хроматографии (20 mM HEPES, 500 mM NaCl, 20 mM имидазол, 8 М мочевина, 10 мМ 2-меркаптоэтанол) и обрабатывали ультразвуком (22 kHz, 1 раз 60 секунд). После обработки ультразвуком суспензию инкубировали 30 минут на орбитальном шейкере при комнатной температуре, затем центрифугировали при 6000 об/мин в течение 20 минут, нерастворимую фракцию отбрасывали. Рекомбинантный белок из надосадочной жидкости очищали на колонке HisTrap (Amersham, США). Элюцию проводили буфером для металлаффинной хроматографии, содержащей 8 М мочевину и 200 мМ имидазол.

Количественное определение концентрации белка в лизате и фракциях определяли по Бредфорду с использованием бычьего сывороточного альбумина в качестве стандарта [9]. Электрофоретическое разделение белков проводили по методу Лэммли [10] в полиакриламидном геле (10 и 12%) в денатурирующих условиях.

 

Вестерн-блот рекомбинантных 2С, 3А, 3В и 3D неструктурных антигенов вируса ящура

Электрофорез неструктурных белков проводили в 11%-ном полиакриламидном геле в присутствии додецилсульфата натрия (ДСН) по методу Лэммли на аппарате для вертикального электрофореза (BioRad, США). Электрофоретический перенос антигенов из геля на нитроцеллюлозную мембрану осуществляли с помощью трансблота (BioRad, США).

Для иммунохимического проявления специфических антигенов нитроцеллюлозную мембрану сначала инкубировали в 1% растворе БСА в течение ночи при 4оС. Затем отмывали по три раза ЗФР и ЗФР-Тв и выдерживали 1,5 ч. при 37оС в разведении моноклональных антител против 6His-tag. После чего носитель вновь отмывали и инкубировали в рабочем разведении антивидовых антител, меченных пероксидазой хрена (1 ч. при 37оС). Повторяли процедуру отмывки и проявляли реакцию. Раствор субстрата готовили непосредственно перед использованием следующим образом: 0,01 г 4-хлор-нафтола (Sigma, США) растворяли в 2 мл метанола, смешивали с 18 мл ЗФР (рН 7,2-7,4) и добавляли 0,01 мл 3% перекиси водорода.

 

Иммуноферментный анализ

Лунки в 96-луночных планшетах иммобилизовывали рекомбинантными неструктурными антигенами в оптимальной концентрации (0,01 мг/мл) в 0,05 М бикарбонатном буфере с рН-9,6 и инкубировали в течение 12 часов при 4оС. Каждый антиген иммобилизовывался в отдельном планшете. После отмывки планшет свободные поверхности лунок блокировали 1%-ным раствором лошадиной сыворотки. После отмывки планшет в лунки вносили двукратные разведения сывороток мышей, иммунизированных 2С3АВ белком, поликлональными антителами против 3АВС и отрицательной контрольной сыворотки, начиная с разведения 1:100 и инкубировали при 37оС в течение 1 часа. Затем отмывали и добавляли антивидовой конъюгат в разведении 1:5000 и инкубировали при 37оС в течение 1 часа. Реакцию проявляли с помощью субстрата, полученный результат учитывали с помощью спектрофотометра.

 

РЕЗУЛЬТАТЫ

В результате анализа литературных данных и аминокислотной последовательности 2С, 3А, 3В и 3D неструктурных антигенов различных типов вируса ящура были выбраны гены наиболее иммуногенных участков антигенов. Проведен дизайн генетических конструкций, несущих гены 3А, 3В и 3D неструктурных белков вируса ящура. В качестве экспрессионной плазмиды для 3А, 3В и 3D белков использован вектор рЕТ32а, для 2С неструктурного белка вируса использована плазмида рЕТ28 (рис. 1).

А – генетическая конструкция для экспрессии 2С неструктурного антигена вируса ящура; Б – генетическая конструкция для экспрессии 3А неструктурного антигена вируса ящура; В – генетическая конструкция для экспрессии 3В неструктурного антигена вируса ящура; Г – генетическая конструкция для экспрессии 3D неструктурного антигена вируса ящура
Рис. 1. Схемы экспрессионных векторов pET32/2С FMDV, pET32/3A FMDV, pET32/3B FMDV, pET32/3D FMDV
A – genetic construction for expression 2C nonstructural antigen of FMDV; Б – genetic construction for expression 3A nonstructural antigen of FMDV; B – genetic construction for expression 3B nonstructural antigen of FMDV; Г – genetic construction for expression 3D nonstructural antigen of FMDV
Fig. 1. Maps of expression plasmids pET32/2С FMDV, pET32/3A FMDV, pET32/3B FMDV, pET32/3D FMDV 
 
А – генетическая конструкция для экспрессии 2С неструктурного антигена вируса ящура; Б – генетическая конструкция для экспрессии 3А неструктурного антигена вируса ящура; В – генетическая конструкция для экспрессии 3В неструктурного антигена вируса ящура; Г – генетическая конструкция для экспрессии 3D неструктурного антигена вируса ящура
Рис. 1. Схемы экспрессионных векторов pET32/2С FMDV, pET32/3A FMDV, pET32/3B FMDV, pET32/3D FMDV
A – genetic construction for expression 2C nonstructural antigen of FMDV; Б – genetic construction for expression 3A nonstructural antigen of FMDV; B – genetic construction for expression 3B nonstructural antigen of FMDV; Г – genetic construction for expression 3D nonstructural antigen of FMDV
Fig. 1. Maps of expression plasmids pET32/2С FMDV, pET32/3A FMDV, pET32/3B FMDV, pET32/3D FMDV 

 

При синтезе гена 3А неструктурного антигена вируса ящура с использованием праймеров 3Аstartrest и 3Astoprest были получены продукты полимеразной цепной реакции длиной 769 пар оснований, что соответствует искомому гену 3А неструктурного антигена. Ген амплифицирован с плазмиды Е8.рЕТ32_2С3АВ, полученной ранее в РГП «Национальный центр биотехнологии» КН МОН РК. В результате синтеза 2С, 3В и 3D генов в условиях de novo получены продукты полимеразной реакции длиной 1000, 530 и 511 пар оснований, соответствующие искомым генам.  

Полученные гены клонировались в промежуточные мультикопейные коммерческие плазмиды pGEM-T, после чего анализировалась их первичная структура. Анализ первичной структуры генов показал полное совпадение нуклеотидной последовательности с искомой последовательностью.

Гены 3А, 3В и 3D неструктурных белков клонировали в экспрессионный вектор по сайтам рестрикции NcoI и XhoI. Ген 2С белка вируса клонировался в экспрессионный вектор рЕТ28 по сайтам EcoRI и XhoI. Экспрессионные плазмиды, несущие вставки генов 2С, 3А, 3В и 3D неструктурных антигенов вируса ящура, трансформировались в компетентные клетки BL21(DE3).

Уровень экспрессии рекомбинантных антигенов определяли культивированием продуцентов в среде с добавлением 0,1, 0,25, 0,5 и 1 мМ изопропил-β-D-1-тиогалактопиранозид. Электрофорез в SDS-полиакриламидном геле показал наличие появления белковых полос с молекулярными массами 40, 45, 38 и 34 кДа, что соответствует планируемым молекулярным массам неструктурных антигенов (рис. 2). Максимальный уровень экспрессии белков был получен при культивировании продуцентов в среде с содержанием 0,5 мМ изопропил-β-D-1-тиогалактопиранозида.

А - рекомбинантный 3В неструктурный белок, 1-6 – очищенные фракции; Б – рекомбинантный 3D неструктурный антиген, 1-6 – очищенные фракции; В – рекомбинантный 3А неструктурный антиген, 1-6 – очищенные фракции;  Г - рекомбинантный 2С неструктурный белок, 1 - проскок через колонку, 2 - промывка колонки, 3,4 - фракция элюированная 50 мМ имидазолом, 5 - 8 - очищенные фракции, ММ - молекулярные маркеры.
Рис. 2. Электрофорез очищенных фракций рекомбинантных неструктурных белков вируса ящура
A – recombinant 3B nonstructural protein, 1-6 – purified fraction; Б – recombinant 3D nonstructural protein, 1-6 – purified fraction; B – recombinant 3A protein, 1-6 – purified fraction; Г – recombinant 2C nonstructural protein, 1 – flow through, 2 – wash, 3, 4 – elution by 50 mM imidazole, 5-8 – purified fraction, MM - molecular markers.
Fig. 2. Electrophoresis of purified fraction of recombinant nonstructural proteins of FMDV
 
А - рекомбинантный 3В неструктурный белок, 1-6 – очищенные фракции; Б – рекомбинантный 3D неструктурный антиген, 1-6 – очищенные фракции; В – рекомбинантный 3А неструктурный антиген, 1-6 – очищенные фракции;  Г - рекомбинантный 2С неструктурный белок, 1 - проскок через колонку, 2 - промывка колонки, 3,4 - фракция элюированная 50 мМ имидазолом, 5 - 8 - очищенные фракции, ММ - молекулярные маркеры.
Рис. 2. Электрофорез очищенных фракций рекомбинантных неструктурных белков вируса ящура
A – recombinant 3B nonstructural protein, 1-6 – purified fraction; Б – recombinant 3D nonstructural protein, 1-6 – purified fraction; B – recombinant 3A protein, 1-6 – purified fraction; Г – recombinant 2C nonstructural protein, 1 – flow through, 2 – wash, 3, 4 – elution by 50 mM imidazole, 5-8 – purified fraction, MM - molecular markers.
Fig. 2. Electrophoresis of purified fraction of recombinant nonstructural proteins of FMDV

 

Для определения наличия гексагистидиновых меток рекомбинантные белки анализировались с помощью моноклональных антител против гексагистидиновой метки в вестерн-блоте. В вестерн-блоте моноклональные антитела против гексагистидиновой метки индуцировали четко видимый сигнал в районе молекулярных масс 40, 45, 38 и 34 кДа, соответствующий молекулярной массе 2С, 3А, 3В и 3D рекомбинантных белков (рис. 3).

А – вестерн-блот 3В неструктурного антигена; Б – вестерн-блот 3D неструктурного белка; В – вестерн-блот 3А неструктурного белка; Г – вестерн-блот 2С неструктурного белка; 1 – рекомбинантный белок после экспрессии; 2 – рекомбинантный белок до экспрессии; 3 – молекулярные маркеры
Рис. 3. Вестерн-блот рекомбинантных неструктурных белков с анти-6His-tag  моноклональными антителами
А – Western blot of 3B nonstructural protein; Б – Western blot 3D nonstructural protein; B – Western blot 3A nonstructural protein; Г – Western blot 2C nonstructural protein; 1 – recombinant protein after expression; 2 – recombinant protein before expression; 3 – molecular markers 
Fig. 3. Western blot of recombinant nonstructural proteins with anti-6His-tag monoclonal antibodies 
 
А – вестерн-блот 3В неструктурного антигена; Б – вестерн-блот 3D неструктурного белка; В – вестерн-блот 3А неструктурного белка; Г – вестерн-блот 2С неструктурного белка; 1 – рекомбинантный белок после экспрессии; 2 – рекомбинантный белок до экспрессии; 3 – молекулярные маркеры
Рис. 3. Вестерн-блот рекомбинантных неструктурных белков с анти-6His-tag  моноклональными антителами
А – Western blot of 3B nonstructural protein; Б – Western blot 3D nonstructural protein; B – Western blot 3A nonstructural protein; Г – Western blot 2C nonstructural protein; 1 – recombinant protein after expression; 2 – recombinant protein before expression; 3 – molecular markers 
Fig. 3. Western blot of recombinant nonstructural proteins with anti-6His-tag monoclonal antibodies 

 

Для изучения перекрестной реакции между полученными антигенами проведена иммунизация лабораторных мышей и получение поликлональных антител к 2С3АВ. Рекомбинантный 2С3АВ антиген был получен ранее в РГП «Национальный центр биотехнологии» КН МОН РК. Иммунизацию мышей проводили по двухнедельной схеме с использованием неполного адъюванта Фрейнда, доза вводимого антигена составляла 50 мкг/мл. Антитела к 3АВС белку вируса ящура являются коммерческими препаратами антител мышей (Absolute Antibody, Великобритания). Перекрестную реакцию с полученными рекомбинантными неструктурными белками определяли иммуноферментным анализом (рис. 4).

А – иммуноферментный анализ с использованием 2С антигена вируса ящура; Б – иммуноферментный анализ с использованием 3А антигена вируса ящура; В – иммуноферментный анализ с использованием 3D антигена вируса ящура; Г – иммуноферментный анализ с использованием 3B антигена вируса ящура; ПС1 – сыворотка против 2С3АВ антигена вируса ящура; ПС2 – сыворотка против 3АВС антигена вируса ящура; ПС3 – сыворотка вакцинированного животного; ОС – отрицательный контроль  
Рис. 4. Иммуноферментный анализ рекомбинантных 2С, 3А, 3В и 3D неструктурных антигенов вируса ящура
A – ELISA with use 2C antigen of FMDV; Б – ELISA with use 3A antigen of FMDV; В – ELISA with use 3D antigen of FMDV; Г – ELISA with use 3B antigen of FMDV; ПС1 – serum against 2C3AB antigen of FMDV; ПС2 – strum against 3ABC antigen of FMDV; ПС3 – serum from vaccinated cows; ОС – negative control  
Fig. 4. ELISA of recombinant 2С, 3А, 3В and 3D nonstructural proteins of FMDV
 
А – иммуноферментный анализ с использованием 2С антигена вируса ящура; Б – иммуноферментный анализ с использованием 3А антигена вируса ящура; В – иммуноферментный анализ с использованием 3D антигена вируса ящура; Г – иммуноферментный анализ с использованием 3B антигена вируса ящура; ПС1 – сыворотка против 2С3АВ антигена вируса ящура; ПС2 – сыворотка против 3АВС антигена вируса ящура; ПС3 – сыворотка вакцинированного животного; ОС – отрицательный контроль  
Рис. 4. Иммуноферментный анализ рекомбинантных 2С, 3А, 3В и 3D неструктурных антигенов вируса ящура
A – ELISA with use 2C antigen of FMDV; Б – ELISA with use 3A antigen of FMDV; В – ELISA with use 3D antigen of FMDV; Г – ELISA with use 3B antigen of FMDV; ПС1 – serum against 2C3AB antigen of FMDV; ПС2 – strum against 3ABC antigen of FMDV; ПС3 – serum from vaccinated cows; ОС – negative control  
Fig. 4. ELISA of recombinant 2С, 3А, 3В and 3D nonstructural proteins of FMDV

 

В результате проведенных исследований было выявлено, что положительная реакция сыворотки против 2С3АВ антигена с рекомбинантным 2С антигеном отмечалась в разведении 1:12800. Оптическая плотность реакции при данном разведении составила 0,623 при длине волны 492 нм. Контрольная отрицательная сыворотка и сыворотка против 3АВС антигена с данным антигеном продемонстрировали отрицательный результат. Положительная реакция сывороток против 2С3АВ и 3АВС антигенов с 3А антигеном отмечались в разведениях 1:6400 и 1:12800 соответственно. Аналогичная картина наблюдалась и с 3В рекомбинантным антигеном. Сыворотки против 2C3AВ и 3АВС антигенов с рекомбинантным 3В антигеном демонстрировали положительную реакцию в высоких разведениях 1:6400. В отношении 3D антигена необходимо отметить, что положительная реакция отмечалась только с сывороткой вакцинированных коров, при этом положительная реакция с этими сыворотками отмечалась в разведении 1:1600. Сыворотки к 2С3АВС и 3АВС антигенам и отрицательная сыворотка с 3D антигеном показали отрицательный результат.

 

ОБСУЖДЕНИЕ

Необходимость получения рекомбинантных неструктурных белков вируса ящура и использование их в дифференциальной диагностике связано с содержанием в вакцинах существенного количества неструктурных белков вируса, оказывающих влияние на DIVA анализ [11]. Одним из наиболее эффективных кандидатов для дифференциации является 2С антиген. По литературным данным, антитела против 2C антигена наблюдаются в сыворотке выздоравливающего крупного рогатого скота, независимо от серотипа, но отсутствуют в сыворотке вакцинированных животных. Таким образом, 2C белок может использоваться в качестве индикатора инфекции ящура [12]. Кроме того, белок 2C, оставаясь на поверхности мембраны, не становится частью очищенной вакцины в отличие от многих других неструктурных белков. Таким образом, в данном исследовании неструктурный 2С белок вируса ящура был выбран для разработки иммуноферментного анализа для DIVA анализа крупного рогатого скота.

Большинство из описанных в литературе тест-систем используют 3А, 3В, 3С неструктурные белки вируса ящура. При этом наиболее эффективным является использование белка ЗА, поскольку он является наиболее консервативным среди неструктурных белков вируса [13]. Полученные автором данные показывают, что белки разных штаммов во многом идентичны (степень идентичности между двумя штаммами составляет 68%) и сходны (степень родства последовательностей 96,7%). Основные различия в аминокислотных последовательностях сосредоточены в С-концевой части полипептидной цепи.

Другим кандидатом является 3D антиген, который также обладает высокой консервативностью и иммуногенностью, поэтому иммуноферментный анализ на основе 3D антигена может использоваться для обнаружения инфекции у животных, подвергшихся любому из серотипов на самых ранних стадиях вспышки болезни [14].

В результате проведенных исследований получены рекомбинантные 2С, 3А, 3В и 3D неструктурные антигены, предназначенные для использования в Дот иммуноферментном анализе. Рекомбинантные неструктурные антигены вируса ящура кодоноптимизированы и экспрессированы в кишечной палочке. Молекулярная масса 2С, 3А, 3В и 3D неструктурных антигенов составила 40, 45, 35 и 35 кДа, соответственно.

Для получения рекомбинантного 2С неструктурного антигена S. Mahajan с соавторами (2013) была использована прокариотическая система экспрессии антигена. Авторы получили рекомбинантный 2С неструктурный антиген с молекулярной массой 38 кДа. Данный антиген авторами был использован для разработки непрямого ИФА для дифференциальной диагностики ящура крупного рогатого скота. Разработанный вариант проверялся панелью сывороток от вакцинированных и инфицированных животных. Результаты анализа в сравнении с коммерческим набором 3AB-ELISA совпадали на 85%. Диагностическая чувствительность и специфичность анализа составили 92,9 и 94,0%, соответственно [11].

В работе A.S. Yakovleva с соавторами (2006) представлены результаты по получению 3A, 3B и 3AB неструктурных антигенов вируса ящура. Антигены авторами были получены путем экспрессии соответствующих генов в кишечной палочке и очищены с помощью металлхелатной аффинной хроматографии. Рекомбинантные белки использованы в качестве антигенов в непрямом иммуноферментном анализе для дифференциации вакцинированных животных от инфицированных. Исследования, проведенные с использованием 200 образцов сывороток крови, показали, что антиген 3А является самым надежным антигеном для дифференциации [15]. При получении различных вариантов ЗА неструктурного антигена в прокариотических системах было выявлено, что наиболее важные антигенные эпитопы находится в районе 85 аминокислот N–конца антигена [16].

В отличие от предыдущих исследователей Kumar R. с соавторами (2012) получили 3D неструктурный антиген в культуре клеток насекомых, используя бакуловирусную систему. По мнению автора, недостатком бактериальной экспрессии является высокая фоновая реактивность рекомбинантных белков в иммуноферментном анализе [14]. Молекулярная масса полученного авторами рекомбинантного антигена составила 53 кДа. Диагностическая чувствительность и специфичность антигена составила 92 и 100%, соответственно.

 

ЗАКЛЮЧЕНИЕ

Получены штаммы микроорганизмов E. coli, продуцирующие рекомбинантные 2С, 3А, 3В и 3D неструктурные антигены вируса ящура. Молекулярная масса полученных рекомбинантных неструктурных антигенов составила 40, 45, 35 и 35 кДа, соответственно. При использовании сывороток против 2С3АВ, 3АВС и сыворотки вакцинированных животных рекомбинантные антигены показали свою диагностическую пригодность для дифференциальной диагностики.

 

Финансирование

Работа профинансирована из средств проекта «Разработка тест-системы для дифференциальной диагностики скрытого ящура на основе выявления антител к неструктурным антигенам 2C, 3A, 3B и 3D» в рамках бюджетной научно-технической программы О.0695 «Создание диагностических препаратов и вакцин на основе использования молекулярно-генетических методов для обеспечения ветеринарной безопасности» на 2015-2017 гг.

 

REFERENCES

 

  1. Sytnik I.I., Tursunkulov S.Z., Abdrakhmanov S.K. Epizooticheskai situatyia i organizatyia meropryitiy protiv ishura v Respublice Kazakhstan. Veterinarnayi Pathologyi, 2007, no. 4, рp. 37-41.
  2. Mustafin B.M., Yachnik L.P., Nasymbaeva A.U. Analys epizooticheskoy situatii po ishuru v Kazakhstane i Kostanayskoy oblasti. Mnogoprophilnay journal Kostanayskogo Gosudarstvennogo Universiteta, A.Baitursynova, 2015, no. 3, рp. 23-29.
  3. De Diego M., Brocchi E., Mackay D., De Simone F. The non-structural polyprotein 3ABC of foot-and-mouth disease virus as a diagnostic antigen in ELISA to differentiate infected from vaccinated cattle. Archives of Virology, 1997, vol. 142, рp. 2021-2033.
    PubMed
  4. Moonen P., van der Linde E., Chénard G., Dekker A. Comparable sensitivity and speci?city in three commercially available ELISAs to differentiate between cattle infected with or vaccinated against foot-and-mouth disease virus. Veterinary Microbiology, 2004, vol. 99, рp. 93-101.
    CrossRef
  5. Braga A.C., Panizzutti R., Ravison J.A., Souza R. The use of non-structural protein of foot and mouth disease virus elisa kits in different serological evaluations in Brazil. Proc. IAEA «The Use of Non-structural Proteins of Foot and Mouth Disease Virus (FMDV) to Differentiate Between Vaccinated and Infected Animals». Vienna, 2007, pp. 79-95.
  6. Maniatis T., Fritsch E., Sambrook J. Molecular cloning. Moscow, Mir, 1982, 479 p.
  7. Hanahan D. Studies of transformation of Escherichia coli with plasmids. Journal of Molecular Biology, 1983, vol. 166, рp. 557-580.
    CrossRef
  8. Sanger F., Nicklen S., Coulson A. DNA sequencing with chain-terminating inhibitors. Proceeding National Academic Science. USA, 1977, vol. 74, рp. 5463-5467.
    PubMed
  9. Bradford M. A rapid and sensitive method fer the quantitation of microgram quantitaties of protein utilizing the principle of protein - due binding. Analytical Biochemistry, 1976, vol. 72, рp. 248-254.
    PubMed
  10. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 1970, vol. 227, рp. 680-685.
    PubMed
  11. Mahajan S., Mohapatra J.K., Pandey L.K., et al. Truncated recombinant non-structural protein 2C-based indirect ELISA for FMD sero-surveillance. Journal of Virological Methods, 2013, vol. 193, рp. 405-414.
    CrossRef
  12. Meyer R.F., Babcock G.D., Newman J.F. et al. Baculovirus expressed 2C of foot-and-mouth disease virus has the potential for differentiating convalescent from vaccinated animals. Journal of Virological Methods, 1997, vol. 65, рp. 33-43.
    CrossRef
  13. Paton D.J., de Clercq K., Greiner M. et al. Application of non-structural protein antibody tests in substantiating freedom from foot-and-mouth disease virus infection after emergency vaccination of cattle. Vaccine, 2006, vol. 24, рp. 6503-6512.
    CrossRef
  14. Kumar R., Hosamani M., Sreenivasa B.P. et al. Expression of Foot-and-Mouth Disease Virus Non-Structural Protein, 3D in Insect Cells and its Application in Detection of Anti-FMDV Antibodies. Indian Journal of Virology, 2012, vol. 23, рp. 326-332.
    CrossRef
  15. Yakovleva A.S., Shcherbakov A.V., Kan’shina A.V. et al. Use of the Recombinant Nonstructural 3A, 3B, and 3AB Proteins of Foot-and-Mouth Disease Virus in Indirect ELISA for Differentiation of Vaccinated and Infected Cattle. Molecular Biology, 2006, vol. 40, no. 1, рp. 146-151.
    CrossRef
  16. Weber S., Granzow H., Weiland F., Marquardt O. Intracellular Membrane Proliferation in E. coli Induced by Foot-and-Mouth Disease Virus 3A Gene Products. Virus Genes, 1996, vol. 12, рp. 5-14.
    CrossRef

 

 

АУСЫЛ ВИРУСТЫН 2С, 3А, 3В ЖӘНЕ 3D РЕКОМБИРНАНТТЫ ҚҰРЫЛЫМДЫҚ ЕМЕС АҚУЫЗДАРДЫ АЛУ

 

Муқантаев Қ.Н., Шустов А.В., Турсунов Қ.А., Інірбай Б., Әдіш Ж., Раманкулов Е.М., Муқанов Қ.Қ.
Ұлтық биотехнология орталығы
Қоргалжын тас жолы, 15/5, Астана, 010000, Қазақстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Аусыл жабайы қостұяқтылар андар мен ауыл шаруашылық малдардын жоғары жұқпалы ауру болып саналады. Жұқпалы аурыдын эпизоотиясі басталғанда және ол тарағанда негізгі және нәтижелі профилактилақ тәсілі ауруга шалдыққыш малдарды вакциналау содан соң иммунданған малдардан буферлык аймақты құру болып табылады. Осыған орай, вакцина егілген малдардың ортасынаң аусыл мен аурған малды анықтау жұқпалы аурыды жоюға жоғары манызы бар. Мақалада аусыл вирустын құрылым емес рекомбинантты 2С, 3А, 3В және 3D ақуыздардың алу матриалдары, олардың иммуноферменттык талдауында диагностикалық қасиеттері көрсетілген. Әртүрлі аусыл вирустардын құрылым емес 2С, 3А, 3В және 3D ақуыздардың аминоқышқыл реттілігінің негізінде антигендердің ерекше иммунды бөлімнің гендері алынған. Аусыл вирустын құрылым емес 2С, 3А, 3В және 3D ақуыздар генді генетикалық құрылымдардың дизайны өткізілді. Экспрессиялайтын плазмида ретінде рЕТ32 векторды пайдаландық.

Жұмыстын нәтижесінде Дот-иммуноферменттык талтауда пайдалануға арналған аусыл вирустын құрыдым емес 2С, 3А, 3В және 3D рекомбинантты ақуыздар алынды. Құрылым емес 2С, 3А, 3В және 3D антигендердің моллекулярлық салмағы, сайкес 40, 45, 38 и 34 кДа құрады.

Негізгі создер: биотехнология, вирус, иммуноферментық талдау, аусыл, антиген, құрылым емес антиген.