3/2016

 

УДК 58.088

 

ВЫДЕЛЕНИЕ ДНК ИЗ ГЕРБАРНЫХ ЛИСТЬЕВ RHODIOLA ROSEA

 

Тагиманова Д.С., Хапилина О.Н., Аменов А.А., Календарь Р.Н.
Национальный центр биотехнологии
Кургальжинское шоссе, 13/5, Астана, 010000, Казахстан
tagds@mail.ru

 

АБСТРАКТ

Получение качественных препаратов ДНК является ключевым моментом при проведении молекулярно-генетических исследований. Растительные ткани, особенно гербарные образцы, являются сложным объектом для экстракции качественных препаратов ДНК ввиду содержания значительных количеств полисахаридов, фенолов, пигментов, которые снижают эффективность ПЦР. В связи с этим возникает необходимость разработки доступного и эффективного метода экстракции геномной ДНК из гербарных образцов. Существуют многочисленные способы очистки нуклеиновых кислот, которые делятся на две основные категории, с использованием органической экстракции и с применением колонок с сорбентами. В статье рассмотрены различные методы экстракции ДНК из гербарных образцов растений родиолы розовой. Результаты исследований показали низкую эффективность методов, основанных на использовании хаотропной соли гуанидинтиоционата, PVP и β-меркаптоэтанола. Выявлено, что использование для экстракции SDS-буфера снижает количественные показатели образцов ДНК. Для экстракции ДНК из гербарного материала наиболее эффективным является протокол на основе кислого CTAB (цетилтриметиламмоний бромид) буфера с горячим хлороформом. Использование слабокислого буфера для экстракции увеличивает выход качественной ДНК, так как препятствует окислительным процессам и образованию пигментов и полисахаридов. При использовании данного метода наблюдается 100% выделение ДНК из всех образцов. Качественные показатели ДНК соответствуют параметрам, которые необходимы при постановке ПЦР реакции.

Ключевые слова: родиола розовая, ценопопуляция, ДНК, гербарий, молекулярно-генетический анализ.


ВВЕДЕНИЕ

Современный уровень молекулярно-генетических исследований позволяет анализировать огромное количество растительных организмов с целью выявления полиморфизма, молекулярных основ фенотипической и генотипической изменчивости и устойчивости к стрессовым факторам среды. Создаются ДНК-коллекции, которые содержат образцы редких, исчезающих и эндемичных растений, что важно для сохранения мирового разнообразия растительных организмов. Все ДНК коллекции сопровождаются описанием создаваемых коллекций, процедур выделения ДНК и ее хранения. Подходы к изучению генетического разнообразия географически отдаленных популяций предполагают использование быстрых, эффективных недорогих методов экстракции из гербарных образцов чистой ДНК, амплифицируемой в ПЦР [1].

На сегодня выделение ДНК является обычной процедурой и разработаны протоколы для большинства растительных объектов, различных тканей и органов. Однако решение проблемы экстракции чистой и недеградированной ДНК из растительных объектов всё ещё остается определяющим этапом в любой сфере использования молекулярно-генетических подходов для изучения растительных организмов. На начальном этапе выделения ДНК из клеток растений требуется эффективное разрушение клеточных стенок. При этом очень важно свести к минимуму процессы деградации и химической модификации ДНК. На следующем этапе важно провести очистку освободившейся высокомолекулярной ДНК от многочисленных примесей, присутствующих в растительном экстракте – полисахаридов, вторичных метаболитов, пигментов, белков и других [2, 3, 4]. Поэтому возникает необходимость выбора метода под новый объект экспериментальным путем.

Сложным материалом для экстрагирования ДНК являются гербарные образцы. Наличие гербарных коллекций делает их потенциально важным источником материала для филогенетических исследований. При использовании гербарных образцов появляется возможность исследовать редкие растительные формы возрастом более чем сотни лет, которые не доступны в природе. Высококачественная ДНК является основным требованием в большинстве молекулярно-генетических исследований. Наибольшее количество ДНК содержат молодые листья, в которых ещё не наступила стадия удлинения клеток и разрушения ядер. Поэтому для выделения ДНК из сухих образцов обычно требуется оптимизация, так как используется меньшее количество образца, который состоит из старых листьев, стеблей или корней [2, 5, 6].

Гербарный материал может поражаться грибами, которые проникают внутрь ткани, ДНК которых будет выделяться одновременно с растительной. Способ приготовления и хранения гербария в последующем определяет качество выделяемой ДНК. Если образцы были высушены при температуре выше 40°С, то они содержат деградированную ДНК, химически связанную с различными компонентами клетки (полисахариды, полифенолы, пигменты, вторичные метаболиты) [6, 7, 8], которые будут снижать выход качественной ДНК для последующих экспериментов. ДНК, подверженная ковалентным сшивкам с полисахаридами, полифенолами и пигментами, не сможет эффективно денатурировать в ПЦР, и тем самым снижается эффективность или полностью ингибируется ПЦР. Тогда как выделяемая ДНК из спор и мицелий грибов, присутствующих в зараженных растительных тканях, будет эффективно выделяться и участвовать в последующих экспериментах. Но основная проблема выделения качественной ДНК из гербарных образцов – это химическая модификация ДНК, образование сшивок с клеточными компонентами, в первую очередь с полисахаридами (лигнином), полифенолами и пигментами.

Цель исследования – подбор эффективного метода выделения тотальной растительной ДНК, экстрагированной из гербарных образцов многолетнего суккулента семейства Толстянковые, родиолы розовой (Rhodiola rosea L.), определение качества выделенной ДНК для последующего проведения молекулярно-генетических исследований.

 

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

В качестве материала исследований были использованы гербарные образцы растений родиолы розовой (Rhodiola rosea) из различных географических отдаленных популяций.  

Выделение ДНК осуществляли с использованием 4 протоколов:

a) SDS (Sodium Dodecyl Sulfate) метод [9, 10];

б) метод с использованием хаотропной соли гуанидинтиоционата (guanidine thiocyanate) [11];

в) стандартного СТАВ (Cetyl Trimethyl Ammonium Bromide) метода с добавлением PVP (Poly Vinyl Pyrrolidone) и β-меркаптоэтанола [8, 12, 13];

г) модифицированного кислого СТАВ метод с применением горячего хлороформа [10, 11, 14].

 

Выделение ДНК методом кислого СТАВ с применением горячего хлороформа

СТАВ – метод выделения ДНК, основан на использовании ионного детергента, который разрушает клеточные стенки и растворяет нуклеиновые кислоты при высокой ионной силе, и при этом осаждает полисахариды.

Для этого гербарные образцы родиолы растирались (1х1 см) в ступке до гомогенного состояния в 1 мл кислого СТАВ буфера (2% СТАВ, 2 M NaCl, 10 mM Na3EDTA, 50 mM HEPES, рН 5,3), гомогенат переносили в 2 мл пробирки Eppendorf Safe-Lock. Затем к образцам добавляли 800 мкл хлороформ-изопропиловой смеси, интенсивно перемешивали на вортексе в течение минуты и инкубировали в термоблоке с температурой 55ºС в течение суток. Затем смесь центрифугировали при 14000 об/мин в течение 5 мин (разделение на 3 слоя). После переносили аккуратно верхнюю водную фазу, стараясь не задеть интерфазу, в новые пробирки. Добавляли к супернатанту равный объем изопропанола (900 мкл), хорошо перемешивали и осаждали ДНК центрифугированием при 14000 об/мин в течение 10 мин, супернатант сливали, осадок на вортексе промывали в 1 мл 70% этанола и осаждали центрифугированием, затем растворяли осадок в 200 мкл 1хТЕ-буфера (1 mM ЭДТА, 10 mM Tris-HCl, pH 8,0).

 

Выделение ДНК с помощью SDS

SDS – метод выделения ДНК, основан на использовании ионного детергента, который разрушает клеточные стенки и белковые структуры. Для этого гербарные образцы родиолы растирались в ступке до гомогенного состояния в 1 мл SDS буфера для экстракции (1% SDS, 0,5 M NaCl), и гомогенат переносили в пробирки объемом 2 мл [10]. Затем центрифугировали при 14000 об/мин в течение 5 мин, после чего супернатант переносили в новую пробирку. К образцам добавляли 700 мкл хлороформ-изопропиловой смеси, интенсивно перемешивали на вортексе в течение минуты и центрифугировали при 14000 об/мин в течение 5 мин. После переносили аккуратно верхнюю водную фазу в новые пробирки. Добавляли к супернатанту равный объем изопропанола (900 мкл), хорошо перемешивали и осаждали ДНК центрифугированием при 14000 об/мин в течение 10 мин, супернатант сливали, осадок на вортексе промывали в 1 мл 70% этанола и осаждали центрифугированием, затем растворяли его в 200 мкл 1хТЕ-буфера (1 mM ЭДТА, 10 mM Tris-HCl, pH 8,0).

Метод выделения ДНК с использованием гуанидинтиоционата основан на способности хаотропных солей гуанидина разрушать и растворять высокомолекулярные компоненты клетки (полисахариды, белки и нуклеиновые кислоты). В зависимости от конечной концентрации гуанидинтиоционата в лизирующем растворе (от 0,5 до 4 М) эффективность экстракции меняется, наилучшая для максимальной концентрации (4 М). Однако при высоких концентрациях хаотропных солей гуанидина происходит денатурация нуклеиновых кислот и полное растворение полисахаридов, которые в последующих этапах будут осаждаться вместе с нуклеиновыми кислотами. Оптимальная концентрация гуанидинтиоционата, при которой выход ДНК оптимальный, варьирует от 0,5 до 2 М, в зависимости от типа тканей и образца.

Этапы протокола с использованием хаотропной соли гуанидинтиоционата (2 M guanidine thiocyanate, 10 mM Na3EDTA, 50 mM HEPES, рН 5,3) проводили аналогично протоколу SDS метода. Лизирующий раствор был закислен до рН 5,3 с помощью HEPES кислоты (рН не требуется доводить), как в случае с кислым СТАВ буфером. Это минимизирует процессы окисления и химической модификации нуклеиновых кислот в процессе экстракции.

Стандартный СТАВ метод выделения ДНК, в присутствии PVP и β-меркаптоэтанола (2% СТАВ, 1,4 M NaCl, 20 mM EDTA, 100 mM Tris-HCl, рН 8,0, 1% PVP, 0,2% β-меркаптоэтанола) проводили по общепринятому протоколу [14, 15].

Качество и количество выделенной ДНК анализировали электрофоретически в 1% агарозном геле и спектрофотометрически (Thermo Scientific™ NanoDrop 2000). Основные критерии оценки качества выделенной ДНК – наличие основного фрагмента тотальной ДНК выше 10 тыс. пар нуклеотидов, по ДНК маркеру, отсутствие деградации, а также минимальное загрязнение полисахаридами при спектрофотометрическом анализе на 230 нм (A260/230 должно приближаться к значению 2).

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

В результате эксперимента установлено, что при использовании протокола с использованием кислого СТАВ с применением горячего хлороформа практически во всех пробах наблюдается высокомолекулярная ДНК (рисунок 1).

При использовании SDS метода наблюдался низкий выход ДНК, выделение геномной ДНК наблюдали не во всех образцах. Методы, основанные на использовании метода с использованием хаотропной соли гуанидинтиоционата и стандартного СТАВ метода с добавлением PVP и β-меркаптоэтанола, также были не эффективны для экстракции ДНК из гербарных образцов.

Протокол с использованием кислого СТАВ буфера и горячей экстракцией с хлороформом оказался наиболее эффективным. Потребность использования горячей экстракции с хлороформом связана с тем, что при стандартном протоколе выделяется небольшое количество ДНК, тогда как горячая экстракция с хлороформом на порядок увеличивает выход ДНК. Использование слабокислого раствора для экстракции увеличивает выход качественной ДНК, так как препятствует окислительным процессам и образованию химических компонентов ДНК с пигментами и полисахаридами. При использовании этого метода экстракции выделения ДНК наблюдали во всех образцах, количество выделившейся ДНК было достаточным для проведения дальнейших экспериментов и ПЦР-амплификации.

Рис. 1. Результат экстракции геномной ДНК из гербарных образцов родиолы розовой с использованием кислого СТАВ метода
Fig. 1. The result of the extraction of genomic DNA from herbarium specimens of Rhodiola rosea with sour CTAB method
 
Рис. 1. Результат экстракции геномной ДНК из гербарных образцов родиолы розовой с использованием кислого СТАВ метода
Fig. 1. The result of the extraction of genomic DNA from herbarium specimens of Rhodiola rosea with sour CTAB method

 

Эффективность метода экстракции ДНК оценивали по таким критериям как частота выделения (%), среднее количество ДНК (мкг/мкл) на образец, качественные показатели ДНК (соотношение А260/А230). Сравнительный анализ используемых методов приведён в таблице 1.

         

Таблица 1. Эффективность различных методов выделения ДНК гербарных образцов растений родиолы розовой
Table 1. The effectiveness of different DNA extraction methods of herbarium specimens of plants Rhodiola rosea

Метод выделения

 

Isolation method

Частота выделения, %

 

Frequency isolation, %

Количество ДНК, мкг/мкл

 

The amount of DNA, mg/ml

Соотношение

А260/А230

 

Ratio

А260/А230

Кислый СТАВ и горячий хлороформ

100

100

1,9

SDS

3

20

1,8

Гуанидинтиоционатный

0

-

-

Стандартный СТАВ с добавлением PVP и β-меркаптоэтанола

0

-

-

 

Для определения качества ДНК была проведена ПЦР-амплификация с использованием стандартных праймеров к рибосомальному ITS (Internal Transcribed Spacer) участку [16, 17, 18, 19], последовательностям генов RUSC и LAL (рисунок 2, 3) [20], а также с помощью многолокусной амплификации для генотипирования, с использованием PBS-праймеров [21, 22].

В процессе амплификации с IТS-праймерами (ITS1-ITS4) получены ПЦР-продукты размером примерно 550 п.н., что соответствует ожидаемым результатам. ПЦР-фрагменты, генерированные с праймерами к гену LAL, имели ожидаемый размер – 500 п.н., что также свидетельствует о специфичности данных праймеров.

Рис. 2. Результаты амплификации ДНК родиолы розовой с ITS праймерами (ITS1, 5’AACCTTATCATTTAGAGGAAGG; ITS4, 5’TCCTCCGCTTATTGATATGC)
Fig. 2. The results of DNA amplification with Rhodiola rosea ITS primer (ITS1, 5’AACCTTATCATTTAGAGGAAGG; ITS4, 5’TCCTCCGCTTATTGATATGC)
 
Рис. 2. Результаты амплификации ДНК родиолы розовой с ITS праймерами (ITS1, 5’AACCTTATCATTTAGAGGAAGG; ITS4, 5’TCCTCCGCTTATTGATATGC)
Fig. 2. The results of DNA amplification with Rhodiola rosea ITS primer (ITS1, 5’AACCTTATCATTTAGAGGAAGG; ITS4, 5’TCCTCCGCTTATTGATATGC)

 

Рис. 3. Амплификация ДНК c LAL праймерами (LA1-F – 5’CATCGTGATGGGGATAGATCATTG; LA1-R – 5’TTCGCTACGTTCTTCATCGATAC)
Fig. 3. Amplification of DNA with the LAL primers (LA1-F – 5’CATCGTGATGGGGATAGATCATTG; LA1-R – 5’TTCGCTACGTTCTTCATCGATAC)
 
Рис. 3. Амплификация ДНК c LAL праймерами (LA1-F – 5’CATCGTGATGGGGATAGATCATTG; LA1-R – 5’TTCGCTACGTTCTTCATCGATAC)
Fig. 3. Amplification of DNA with the LAL primers (LA1-F – 5’CATCGTGATGGGGATAGATCATTG; LA1-R – 5’TTCGCTACGTTCTTCATCGATAC)

 

В процессе амплификации с IТS-праймерами получены ПЦР-продукты размером примерно 550 bp, что соответствует ожидаемым результатам. ПЦР-фрагменты, генерированные с праймерами к гену lal, имели ожидаемый размер – 500 bp, что также свидетельствует о специфичности данных праймеров. 

Также в процессе амплификации с праймерами к хлоропластному гену rusc были получены продукты, соответствующие ожидаемым, размер которых составил 980 bp.

Анализ результатов многолокусной амплификации с помощью PBS-праймерами позволил выявить молекулярно-генетические различия между исследуемыми образцами из географически удаленных популяций.

 

ВЫВОДЫ

В результате было установлено, что для выделения геномной ДНК из гербарных образцов многолетнего суккулента семейства Толстянковые, родиолы розовой наиболее эффективен протокол с использованием кислого СТАВ с применением горячего хлороформа, поскольку при использовании данного метода удалось получить ДНК из всех образцов, и соотношение А260/230 соответствует качеству, которое необходимо при постановке ПЦР-реакции или других молекулярно-биологических экспериментов.

 

Финансирование

Работа выполнена при поддержке Министерства образования и науки Республики Казахстан в рамках проекта 4869/ГФ4 «Исследование генно-географического разнообразия природных популяций родиолы розовой (rhodiola rosea l.) Казахстана с помощью секвенирования некодирующей части генома (нетранскрибируемые спейсеры и интроны генов)» на 2015-2017 гг. (№ ГР0115РК01775).

 

REFERENCES

 

  1. Sambrook J., Fritsch E.F., Maniatis T. Molecular Cloning. A Laboratory Manual. New York, Cold Spring Harbor Laboratory, 1989, pp. 545.
  2. Rogers S.O., Bendich A.J. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Mol Biol., 1985, vol. 5, pp. 69-76.
    CrossRef
  3. Chum P.Y., Haimes J.D., Andre C.P., et al. Genotyping of plant and animal samples without prior DNA purification. J Vis Exp., 2012.
    CrossRef
  4. Guertler P., Eicheldinger A., Muschler P., et al. Automated DNA extraction from pollen in honey. Food Chem., 2014, vol. 149, pp. 302-6.
    CrossRef
  5. Couch J.A., Fritz P.J. Isolation of DNA from plants high in polyphenolics. Plant Molecular Biology Reporter., 1990, vol. 8, pp. 8-12.
    CrossRef
  6. Ristaino J.B., Groves C.T., Parra G.R. PCR amplification of the Irish potato famine pathogen from historic specimens. Nature, 2001, vol. 411, no. 6838, pp. 695-697.
    CrossRef
  7. Soltis P.S., Soltis D.E. Ancient DNA: Prospects and limitations. New Zealand Journal of Botany, 1993, vol. 31, pp. 203-209.
    CrossRef
  8. Healey A., Furtado A., Cooper T., Henry R.J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods, 2014, vol. 10, pp. 21.
    CrossRef
  9. SDS Extraction Buffer. Cold Spring Harbor Protocols, 2012, vol. 2012, no. 11. pdb.rec072496-pdb.rec072496.
    CrossRef
  10. Chabi Sika K., Kefela T., Adoukonou-Sagbadja H., et al. A simple and efficient genomic DNA extraction protocol for large scale genetic analyses of plant biological systems. Plant Gene, 2015, vol. 1, pp. 43-45.
    CrossRef
  11. Kalendar R. Total DNA isolation protocol, 2016.
    link
  12. Allen G.C., Flores-Vergara M.A., Krasynanski S., et al. A modified protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. Nat Protoc, 2006, vol. 1, no. 5, pp. 2320-2325.
    CrossRef
  13. Azmat M.A., Khan I.A., Cheema H.M., et al. Extraction of DNA suitable for PCR applications from mature leaves of Mangifera indica L. J Zhejiang Univ Sci B, 2012, no. 4, pp. 239-243.
    CrossRef
  14. Doyle J.J., Doyle J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 1987, vol. 19, pp. 11-15.
    link
  15. Doyle J., Doyle J. Isolation of plant DNA from fresh tissue. Focus, 1990, vol. 12, pp. 13-15.
    link
  16. Gardes M., Bruns T.D. ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Molecular Ecology, 1993, vol. 2, no. 2, pp. 113-118.
    CrossRef
  17. Hsiao C., Chatterton N.J., Asay K.H., Jensen K.B. Phylogenetic relationships of the monogenomic species of the wheat tribe, Triticeae (Poaceae), inferred from nuclear rDNA (internal transcribed spacer) sequences. Genome, 1995, vol. 38, no. 2, pp. 211-223.
    link
  18. Schoch C.L., Seifert K.A., Huhndorf S., et al. Fungal Barcoding C., Fungal Barcoding Consortium Author L. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA, 2012, vol. 109, no. 16, pp. 6241-6246.
    CrossRef
  19. Vilgalys_lab. Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA.
    link
  20. Sang T., Crawford D., Stuessy T. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am J Bot., 1997, vol. 84, pp. 1120.
    PubMed.
  21. Kalendar R., Antonius K., Smýkal P., Schulman A.H. iPBS: a universal method for DNA fingerprinting and retrotransposon isolation. Theoretical and Applied Genetics, 2010, vol. 121, no. 8, pp. 1419-1430.
    CrossRef
  22. Kalendar R., Schulman A.H. Transposon-based tagging: IRAP, REMAP, and iPBS. Methods in Molecular Biology, vol. 1115, 2014, pp. 233-255.
    CrossRef

 

RHODIOLA ROSEA ГЕРБАРДЫ ЖАПЫРАҚТАРЫНАН ДНҚ БӨЛІП АЛУ

 

Тагиманова Д.С., Хапилина О.Н., Аменов А.А., Календарь Р.Н.
Ұлттық биотехнология орталығы
Қорғалжын тас жолы, 13/5, Астана, 010000, Қазақстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Молекула-генетикалық зерттеулерді жүргізу кезінде сапасы жоғарғы ДНҚ бөліп алу маңызды кезеңдердің бірі болып табылады. Құрамында ПТР-дың тиімділігін азайтатын полисахаридтер, фенолдар, пигменттер көп болғандықтан өсімдік ұлпаларынан, әсіресе, гербарийлі материалдан сапасы жоғарғы ДНҚ бөліп қиын. Осыған байланысты гербарийлі үлгілерден геномды ДНҚ бөліп алудың тиімді протоколын әзірлеудің қажеттігі туындайды. Нуклеин қышқылдарын тазалаудың көптеген әдістері бар, олар екі негізгі категорияға бөлінеді, біреуі органикалық экстракцияға, ал екіншісі сорбенттері бар колонкаларды пайдалануға негізделеді. Мақалада қызғылт семізоттың гербарийлі өсімдіктерінен ДНҚ экстракциялаудың әр түрлі әдістері қарастырылған. Зерттеу нәтижелері хаотропты тұз гуанидинтиоционатқа, PVP мен β-меркаптоэтанолға негізделген әдістердің тиімділігі төмен болатынын көрсетті. Экстракция үшін SDS-буферін пайдалану ДНҚ үлгілерінің сандық сапасын азайтады. Гербарды материалдан ДНҚ бөліп алу үшін ыстық хлороформды пайдалану арқылы қышқыл СТАВ-қа (цетилтриметиламмоний бромид) негізделген протокол ең тиімді болғаны анықталды. Экстракциялау үшін қышқылдығы аз буферді пайдалану сапалы ДНҚ бөліп алуға мүмкіндік береді, өйткені ол тотықтыру процестерінің жүруі мен пигменттер мен полисахаридтер бар ДНҚ-ң химиялық компоненттерінің түзілуіне кедергі болады. Бұл әдісті пайдалану кезінде барлық үлгілерден 100% ДНҚ бөліп алынды. ДНҚ сапалық көрсеткіштері ПТР реакциясын қоюға қажетті сапаға сәйкес келеді.

Негізгі сөздер: қызғылт семізот, ценопопуляция, ДНҚ, гербарий, молекула-генетикалық талдау.