3/2016

 

УДК 578.2: 632.3

 

МОЛЕКУЛЯРНАЯ ДИАГНОСТИКА ВИРОИДА ВЕРЕТЕНОВИДНОСТИ КЛУБНЕЙ КАРТОФЕЛЯ В РЕСПУБЛИКЕ КАЗАХСТАН

 

Надирова Л.Т., Станбекова Г.Э., Бейсенов Д.К., Искаков Б.К.
Институт молекулярной биологии и биохимии им. М.А. Айтхожина
ул. Досмухамедова, 86, Алматы, 050012, Казахстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

АБСТРАКТ

Урожайность картофеля, одного из наиболее употребляемых продуктов растениеводства, может значительно снижаться из-за вироида веретеновидности клубней картофеля (ВВКК). В настоящее время из-за отсутствия эффективных методов оздоровления картофеля от ВВКК большое значение имеют методы диагностики вироида для предотвращения его дальнейшего распространения.

Впервые на территории Республики Казахстан проведена молекулярная диагностика ВВКК – возбудителя болезни картофеля «готика». Веретеновидные и грушевидные клубни картофеля, собранные в частных фермерских хозяйствах Алматинской области, были выращены в условиях теплицы. Препараты РНК, выделенные из листьев тестируемых растений, анализировались на присутствие ВВКК. Обратная транскрипция, совмещённая с полимеразной цепной реакцией (ОТ-ПЦР) в присутствии специфичных праймеров, выявила в ряде образцов ДНК-фрагмент длиной 360 пар нуклеотидов (пн). Соответствие их ВВКК было подтверждено секвенированием. В дальнейшем клонированный нами изолят ВВКК был использован в качестве меченого зонда для диагностики вироида в других партиях клубней. ОТ-ПЦР и гибридизационный анализ нуклеиновых кислот выявил присутствие ВВКК в 26% отобранных веретеновидных клубней картофеля.

Ключевые слова: вироид веретеновидности клубней картофеля, диагностика, обратная транскрипция, ПЦР, нозерн-гибридизация.


ВВЕДЕНИЕ

Картофель, возделываемый на площади более 190000 га, в Казахстане является одним из самых потребляемых продуктов растениеводства. Однако урожайность картофеля невысокая, примерно 180 ц/га. Несмотря на обширность посевных площадей, Казахстан является импортёром картофеля. Более того, импортируется в больших количествах посевной материал. Импорт идёт в основном из Китая и стран СНГ (Россия и Кыргызстан). Одной из причин снижения урожая и ухудшения качества клубней картофеля является вироидная болезнь, также известная как «готика». Степень поражения картофеля данным заболеванием в южных регионах Казахстана достигает 5% [1].

Заболевание картофеля, вызываемое ВВКК, встречается на всех континентах, а урожай клубней может снижаться до 65% [2]. В Европе ВВКК считается карантинным объектом. «Готика» идентифицирована также в России, Украине, Средней Азии, Армении, Закавказье, Белоруссии.

Начало 90-х годов было отмечено несколькими случаями эпифитотий в России, причиной которой, как выяснилось, было отсутствие единых методик анализа на наличие ВВКК, оздоровлённого от вирусов семенного картофеля. В результате чего ВВКК распространился фактически по всем регионам России [3]. В настоящее время ВВКК включен в список карантинных объектов, ограниченно распространенных на территории Российской Федерации.

Вироид веретеновидности картофеля (ВВКК или PSTVd от Potato Spindle Tuber Viroid) – патоген, открытый лишь в конце 1960-х годов [4]. Геном представлен одноцепочечной РНК, размер которой обычно составляет 359 нуклеотидов [5], реже 358 или 360 [6, 7]. Также был найден вироид размером в 356 нуклеотидов в дикорастущих линиях картофеля Solanum spp. [8] и томате (Lycopersicon esculentum) [9]. Его РНК имеет либо форму замкнутого кольца, либо структуру типа шпильки. В обоих случаях комплементарные пары оснований соединены водородными связями, образуя двунитевую РНК, подобную ДНК. Длина составляет 50 нм или десятую часть генома мельчайшего вируса. Он реплицируется подобно вирусам, т.е. синтезируя комплементарную цепь, которая функционирует как матрица. При этом вироиды используют ферментные системы клетки-хозяина.

К сожалению, в настоящее время нет эффективных методов оздоровления картофеля от ВВКК, поэтому большую роль играют методы диагностики для предотвращения дальнейшего распространения ВВКК через посадочный материал. Для обнаружения ВВКК в диагностике используют индикаторные растения томата [10], гель-электрофорез нуклеиновых кислот [11], молекулярную гибридизацию нуклеиновых кислот с соответствующим зондом [12]. Дрыгин Ю.Ф. с соавторами разработали т.н. МГА‑ИФА-технологию для детекции ВВКК с помощью специфических кДНК-зондов, меченных диен-платиной. Чувствительность метода позволяет выявить до 100 молекул РНК вироида на клетку [13]. МГА‑ИФА-технология позже была разработана также и для вирусных объектов [14]. Относительно недавно внедрён метод ОТ-ПЦР в реальном времени [15]. Однако широкое применение в практике в силу относительной простоты и высокой чувствительности получил стандартный ОТ-ПЦР метод.

В отличие от вирусов молекулярная диагностика ВВКК в Казахстане до сегодняшнего дня не проводилась. Отчасти причина кроется в самой природе возбудителя. Дело в том, что в силу небольшого размера его геном не кодирует никаких белков и широко распространённый для диагностики вирусов иммуноферментный анализ в данном случае не применим.

Целью настоящей работы явилось выявление местных изолятов вироида картофеля на территории Республики, в частности в Алматинской области. В настоящей работе для обнаружения ВВКК были использованы визуальный осмотр клубней, стандартный ОТ-ПЦР метод амплификации и нозерн-гибридизация. Все они входят в перечень рекомендуемых диагностических протоколов для ВВКК согласно международно согласованным стандартам на семенной картофель, разработанный Европейской Экономической Комиссией Организации Объединенных Наций (ЕЭК ООН) [16].

 

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Выделение РНК. Выделение РНК производили с помощью Tri-reagent (Sigma), согласно прилагаемому протоколу.

Реакция обратной транскрипции (ОТ). Для синтеза кДНК реакционная смесь объёмом 11 мкл содержала следующие компоненты: 1 мкг тотальной РНК и 20 пмоль обратного праймера “PSTVd-for-XbaI”. Смесь инкубировалась при 70оС 5 мин, охлаждалась во льду. Затем добавляли 4 мкл 5× буфера для обратной транскрипции (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM Mg Cl2), каждого из дезоксирибонуклеозид-трифосфатов (дНТФ) с конечной концентрацией 1 мМ, 20 ед. ингибитора рибонуклеаз (Thermo Scientific) и воды до конечного объёма 19 мкл. Пробирки инкубировали при 37оС 5 мин, после чего добавляли 200 ед. обратной транскриптазы M-MuLV (Thermo Scientific). Реакционную смесь инкубировали при 42оС 60 мин. Фермент инактивировали при 70оС в течение 10 мин и охлаждали во льду.

Полимеразная цепная реакция (ПЦР). Амплификация кДНК генома ВВКК проводилась с использованием Pwo ДНК-полимеразы (Roche) и праймеров “PSTVd-for-XbaI” и “PSTVd-rev-BamHI”. В качестве матрицы использовалась полученная в ходе РОТ кДНК. Объём реакционной смеси составлял 20 мкл. Реакционная смесь содержала следующие компоненты: 10 mM Tris-HCl (pH 8,85), 25 mM KCl, 5 mM (NH4)2SO4, 2 mM MgSO4, по 10 пмоль прямого и обратного праймера, 0,2 мМ каждого из дНТФ, 1 ед. Pwo ДНК-полимеразы и 2 мкл кДНК. ПЦР проводили в следующем режиме: начальная денатурация (94оС – 3 мин), 30 циклов амплификации (94оС – 1 мин, 60оС – 1 мин, 72оС – 1 мин), завершающая элонгация (72оС – 5 мин).

Последовательности праймеров, использованных в работе:

PSTVd-for-XbaI: 5' CTATCTAGACCCGGGGAAACCTGGA;

PSTVd-rev-BamHI: 5' CTAGGATCCCTGAAGCGCTCCCCGA.

Cайты рестрикции XbaI и BamHI (подчёркнуты) на 5' концах праймеров были введены для дальнейшего клонирования ампликона в РНК-интерферирующий вектор, который был использован для получения трансгенных растений (данные не опубликованы), и не мешают амплификации кДНК ВВКК.

Клонирование кДНК и секвенирование. Полученные ампликоны были обработаны рестриктазами XbaI и BamHI, проанализированы в 2% агарозном геле и очищены с помощью набора реагентов Gel Extraction Kit (Thermo Scientific). Очищенные фрагменты были клонированы в плазмидном векторе pBluescript II SK по указанным сайтам. Первичная нуклеотидная последовательность полученных клонов была определена методом циклического секвенирования. Образцы готовили с помощью набора реагентов ABI Prism Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Секвенирование проводили на анализаторе ABI PRISM ® 310 Genetic Analyzer (Applied Biosystems).

Нозерн-гибридизация. Рекомбинантная плазмида pBluescript(PSTVd) была предварительно линеаризована по сайту EcoRI и использована для синтеза РНК-зонда, меченого дигоксигенином из набора реагентов DIG RNA Labeling Kit (Roche).

Электрофорез РНК, перенос РНК на положительно заряженную нейлоновую мембрану, гибридизацию, детекцию сигналов проводили по протоколу, приложенному к набору реагентов DIG Luminescent Detection Kit For Nucleic Acids (Roche).

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Наличие ВВКК определяли в четырёх партиях клубней картофеля, собранных осенью 2014 года в частных хозяйствах Алматинской области, на которую в республике приходится наибольшая доля выращиваемого картофеля (20%). Были отобраны клубни, которые имели веретенообразную или грушевидную форму с большим количеством глубоко посаженных глазков, что характерно для болезни «готика» (рис. 1).

Рис. 1. Образцы клубней картофеля, тестируемых на присутствие ВВКК
Fig. 1. Samples of potato tubers tested for the presence of PSTVd
 
Рис. 1. Образцы клубней картофеля, тестируемых на присутствие ВВКК
Fig. 1. Samples of potato tubers tested for the presence of PSTVd

 

Отобранные клубни были высажены в почвогрунт, помещены в условия теплицы и через 6-8 недель листья образовавшихся побегов были использованы для выделения препаратов тотальной РНК. РНК выделяли из 200 мг листовой ткани каждого образца. 1 мкг РНК использовали в реакции обратной транскрипции в присутствии обратного праймера. Последующая ПЦР в присутствии обоих праймеров и электрофорез в 2% агарозном геле выявил в ряде образцов наличие фрагмента с ожидаемым размером в 360 пн (рис. 2).

Продукты амплификации в лунках с номерами 3, 5, 7, 8, 9, 10 соответствуют размеру кДНК-ВВКК (360 пн). 12 – контрольная ОТ-ПЦР с РНК, выделенной из здорового растения. М – маркерные ДНК 100 пн (Fermentas)
Рис. 2. Электрофореграмма продуктов амплификации ОТ-ПЦР с праймерами, специфичными к геному ВВКК
Amplification products in the 3, 5, 7, 8, 9, 10 wells matches in size with PSTVd-cDNA (360 bp). 12 – control RT-PCR with RNA from the wild type plant. M – 100 bp DNA marker (Fermentas)
Fig. 2. Electrophoregram of the RT-PCR products amplified with PSTVd‑specific primers
 
Продукты амплификации в лунках с номерами 3, 5, 7, 8, 9, 10 соответствуют размеру кДНК-ВВКК (360 пн). 12 – контрольная ОТ-ПЦР с РНК, выделенной из здорового растения. М – маркерные ДНК 100 пн (Fermentas)
Рис. 2. Электрофореграмма продуктов амплификации ОТ-ПЦР с праймерами, специфичными к геному ВВКК
Amplification products in the 3, 5, 7, 8, 9, 10 wells matches in size with PSTVd-cDNA (360 bp). 12 – control RT-PCR with RNA from the wild type plant. M – 100 bp DNA marker (Fermentas)
Fig. 2. Electrophoregram of the RT-PCR products amplified with PSTVd‑specific primers

 

Далее кДНК, полученные с РНК из образцов под номерами 5, 7, 8, 9, были клонированы в составе плазмидного вектора pBluescript II SK по сайтам рестрикции XbaI и BamHI, которые присутствуют на концах праймеров и в множественном сайте клонирования вектора. Последующее определение первичной нуклеотидной последовательности показало, что все четыре кДНК-клона идентичны и имеют длину 358 пн. Сравнительный анализ на сервере Blast базы данных NCBI показал 100% совпадение выделенного нами изолята с ранее обнаруженным вариантом ВВКК (GenBank: X76846), который относится по степени вирулентности к суровым штаммам [17].

Для диагностики ВВКК в других партиях клубней был использован альтернативный метод диагностики – гибридизация нуклеиновых кислот. При этом клонированная последовательность ВВКК использовалась для создания РНК-зонда. Рекомбинантная плазмида pBluescript(PSTVd) была предварительно линеаризована по сайту Ecl136II и использована в качестве матрицы для синтеза меченого нерадиоактивным дигоксигенином транскрипта с помощью Т7-РНК-полимеразы. Зонд соответствовал «-» цепи кДНК. Положительным контролем в эксперименте служил транскрипт, полученный с той же плазмиды, предварительно линеаризованной по сайту EcoRI. Транскрипцию «+» цепи проводили с помощью Т3-РНК-полимеразы в присутствии немеченых рибонуклеозидтрифосфатов. РНК из 200 мг листовой ткани тестируемых растений была выделена также с помощью реагента тризол. По 2 мкл (из 30 мкл) каждого препарата были разделены электрофоретически в 1% агарозном геле, содержащем формальдегид. Результаты последующей проведенной нозерн-гибридизации приведены на рис. 3. Как видно из рисунка 3, в 12 растениях из 58 проанализированных присутствует РНК с размером, соответствующим положительному контролю (358 нт). Препараты РНК из растений под номерами 2, 3, 7, 11, 13, 22, 23, 24, 25 показали относительно сильный сигнал гибридизации, в отличие от номеров 5, 26, 44. Разная интенсивность сигналов отражает, по-видимому, различие в количестве копий присутствующего в растениях ВВКК, так как анализировалось приблизительно одинаковое количество РНК, выделенных по одной методике.

1-58 – РНК из растений картофеля, тестируемых на присутствие ВВКК; 59 – 20 пг контрольной РНК; 60 – РНК из здорового растения
Рис. 3. Нозерн-гибридизация
1-58 – RNA from the potato plants tested for the presence of PSTVd; 59 – 20 pg of the control RNA; 60 – RNA from the healthy plant
Fig. 3. Northern blot
 
1-58 – РНК из растений картофеля, тестируемых на присутствие ВВКК; 59 – 20 пг контрольной РНК; 60 – РНК из здорового растения
Рис. 3. Нозерн-гибридизация
1-58 – RNA from the potato plants tested for the presence of PSTVd; 59 – 20 pg of the control RNA; 60 – RNA from the healthy plant
Fig. 3. Northern blot

 

В результате данных экспериментов присутствие ВВКК было показано в 18 из 69 отобранных образцах картофеля, что соответствует 26% степени пораженности проанализированных растений.

Полученные данные говорят о серьёзности положения данного вопроса, так как выявленный нами штамм относится к суровым и впервые был выявлен в Польше, импорт овощей откуда в Казахстан составляет всего 1%. В Казахстане только начато производство безвирусного картофеля, этим занимается в частности ТОО «Bioprom Technologies» (Акмолинская область, г. Степногорск). Повышение температуры при термотерапии и выращивании миниклубней в теплице при получении безвирусного картофеля только способствуют репликации ВВКК. Оздоровленный от вирусов семенной картофель, но не проверенный на ВВКК, может послужить в дальнейшем источником распространения вироидной болезни по всей Республике.

 

Финансирование

Работа выполнена в рамках научно-технической программы О.0592 «Разработка научных основ повышения устойчивости пшеницы и картофеля к фузариозу и вироидам на основе методов молекулярной и клеточной биологии и создание на их основе исходных линий и диагностикумов для ускоренной селекции», финансируемой Комитетом науки Министерства образования и науки Республики Казахстан.

 

REFERENCES

 

  1. Ospanova G.S., Bozshataeva G.T., Turabaeva G.K., Alikhanova A. Viral solanaceae diseases in Kazakhstan. International journal of applied and fundamental research, 2014, no. 3, pp. 62-64.
  2. Salazar L.F. Potato spindle tuber viroid. In: Plant Protection and Quarantine, 1989, vol. 2. Selected Pests and Pathogens of Quarantine Significance (Kahn R.P., ed), pp. 155-167.
  3. Drygin Yu.F., Musin S.M., Kondakova O.A., et al. Molecular diagnostic of the recovered potato contamination by the spindle tuber viroid. Reports of RAAS, 1996, no. 6, pp. 24-25.
  4. Diener T., Raymer W. Potato spindle tuber virus: a plant virus with properties of a free nucleic acid. Science, 1967, vol. 158, pp. 378-381.
    CrossRef PubMed
  5. Gross H.J., Domdey H., Lossow C., et al. Nucleotide sequence and secondary structure of potato spindle tuber viroid. Nature, 1978, vol. 273, pp. 203-208.
    CrossRef
  6. Herold T., Haas B., Singh R.P., et al. Sequence analysis of five new field isolates demonstrates that the chain length of potato spindle tuber viroid (PSTVd) is not strictly conserved but is variable as in other viroids. Plant Mol. Biol., 1992, vol. 19, pp. 329-333.
    CrossRef PubMed
  7. Lakshman D., Tavantzis S. Primary and secondary structure of a 360-nucleotide isolate of potato spindle tuber viroid. Arch. Virol., 1993, vol. 128, pp. 319-331.
    CrossRef PubMed
  8. Puchta H., Herold T., Verhoeven K., et al. A new strain of potato spindle tuber viroid (PSTVd-N) exhibits major sequence differences as compared to all other strains sequenced so far. Plant Mol. Biol., 1990, vol. 15, pp. 509-511.
    CrossRef PubMed
  9. Behjatnia S.A.A., Dry I.B., Krake L.R., et al. New potato spindle tuber viroid and tomato leaf curl geminivirus strains from a wild Solanum sp. Phytopathology, 1996, vol. 86, pp. 880-886.
  10. Raymer W.B., O’Brien M.J. Transmission of potato spindle tuber virus to tomato. Am. Potato J., 1962, vol. 39, pp. 401-408.
    CrossRef
  11. Morris T.J., Wright N.S. Detection on polyacrylamide gel of a diagnostic nucleic acid from tissue infected with potato spindle tuber viroid. Am. Potato J., 1975, vol. 52, pp. 57-63.
    CrossRef
  12. Owens R.A., Diener T.O. Sensitive and rapid diagnosis of potato spindle tuber viroid disease by nucleic acid hybridization. Science, 1981, vol. 213, pp. 670-672.
    CrossRef PubMed
  13. Kondakova O.A., Drygin Yu.F. Diagnostic of the potato viroid disease by the (dien)Pt?DNA probe. Biotechnologiya, 1999, vol. 4, pp. 83-90.
  14. Drygin Yu.F., Chirkov S.N., Kondakova O.A., et al. Highly sensitive technologies for the molecular diagnosis of potato viral and viroid infections. Achievements of APK science and technique, 2007, no. 7, pp. 20-27.
  15. Boonham N., Perez L.G., Mendez M.S., et al. Development of a real-time RT?PCR assay for the detection of potato spindle tuber viroid. J. Virol. Methods, 2004, vol. 116, pp. 139-146.
    CrossRef PubMed
  16. UNECE Standard S-1 concerning the marketing and commercial quality control of Seed Potatoes. UNECE Guide to Seed Potato Diseases, Pests and Defects. United Nations, New York and Geneva, 2014, 108 p.
  17. Góra A., Candresse T., Zagórski W. Analysis of the population structure of three phenotypically different PSTVd isolates. Arch Virol., 1994, vol. 138, no. 3-4, pp. 233-245.
    CrossRef PubMed

 

КАРТОП ТҮБІР ТЕГІНІҢ ҰРШЫҚСИЯҚТАНУЫНЫҢ (КТҰ) МОЛЕКУЛАЛЫҚ ДИАГНОСТИКАСЫ ҚАЗАҚСТАН РЕСПУБЛИКАСЫНДА

 

Надирова Л.Т., Станбекова Г.Э., Бейсенов Д.К., Искаков Б.К.
М.А. Айтхожин атындағы молекулалық биология және биохимия институты
Досмухамедов көш., 86, Алматы, 050012, Қазақстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Картоптың өнімділігі, ауылшаруашығында ең көп пайдаланатын азықтың түрі болғандықтан, картоп түбір тегінің ұршықсияқтануынан (КТҰ) едәуір кеміп кетеді. Қазір одан құтылудың тиімді әдістері жоқ болғасын, ол әрі қарай жайылмау үшін, вироидты диагностикалау керек.

Қазақстан Республикасы территориясында бірінші рет – картоп ауруының қоздыртқышы «готика» КТҰ-ның молекулалық диагностикасы өткізілді. Ұршықсияқтанған мен алмұртсияқтанған картоп түбіртектері Алматы облысының жылыжайларында жеке фермерлік шаруашылықтардан жинап әкелінді. Тексерілетін өсімдіктерден алынған РНҚ препараттары КТҰ бар/жоғына талдау жасалды. Кері транскрипция (КТ ПТӘ), полимераздық тізбек әрекеті мен бірлескен арнаулы праймерлері бар, кейбір ұзындығы 360 нуклеотид жұптарының ДНҚ-фрагменттерінің үлгілерінде КТҰ бары секвенация арқылы анықталды. Одан кейін бөлініп алыған КТҰ белгіленген зонд вироид диагностикасын түбіртектердің басқа партияларында клондалып пайдаланылды.

КТ-ПТӘ және нуклеин қышқылдарының гибридизациялық талдауы, КТҰ барын ұршықсияқтануының 26% картоп түбіртегінде КТҰ барын анықтады.

Негізгi сөздер: картоп түйнегінің вироиды, диагностика, кері транскрипция, ПТӘ, нозерн-гибридизация.