3/2015

УДК 619:578.224

 

ПОЛУЧЕНИЕ РЕКОМБИНАНТНОГО ИММУНОГЕННОГО ДОМЕНА НУКЛЕОПРОТЕИНА ВИРУСА БЕШЕНСТВА

 

Турсунов К., Бегалиева А., Інірбай Б., Муканов К.К., Раманкулов Е.М., Шустов А.В., Мукантаев К.Н.
Национальный центр биотехнологии
ш. Кургальжинское, 13/5, Астана, 010000, Казахстан
lii
@biocenter.kz

 

АБСТРАКТ

В связи с широким распространением бешенство является актуальной проблемой для Республики Казахстан. Основными источниками болезни на территории республики являются очаги двух типов: природные, в которых вирус поддерживается главным образом в популяциях диких хищников и грызунов, и антропургические очаги, в которых циркуляция вируса осуществляется в популяции домашних животных. Способность вируса к быстрому распространению определяет важную роль диагностических исследований в системе профилактических и карантинных мероприятий. В связи с увеличением темпов развития диагностических методов встала проблема несоответствия антигенов и антител уровню разрабатываемых тест-систем. Диагностической роли отдельных частей нуклеопротеина вируса бешенства в настоящее время уделено большое внимание. В результате проведенных исследований создана генетическая конструкция, экспрессирующая С-концевой фрагмент нуклеопротеина вируса бешенства. Полученная генетическая конструкция трансформирована в компетентные клетки E. coli. Отработаны параметры выделения и очистки рекомбинантного нуклеопротеина вируса бешенства. Фрагмент несет наиболее иммуногенный сайт нуклеопротеина, расположенный в позиции 360-389 аминокислот. Молекулярный вес рекомбинантного антигена – 42 kDa. Сыворотка мышей, иммунизированных фиксированным вирусом бешенства, специфически реагировала с рекомбинантным С-концевым фрагментом нуклеопротеина вируса. Сыворотка мышей, иммунизированных рекомбинантным антигеном и фиксированным вирусом, показала перекрестную реакцию в высоких титрах разведения.

Ключевые слова: вирус бешенства, нуклеопротеин, рекомбинантный антиген, генетическая конструкция, иммуногенный домен, штамм-продуцент.

 

OBTAINING THE RECOMBINANT IMMUNOGENIC DOMAIN OF THE RABIES VIRUS NUCLEOPROTEIN

 

Tursunov K., Begaliyeva A., Inirbay B., Mukanov K.К., Ramanculov Е.М., Shustov А.В., Mukantayev К.Н.
National Center for Biotechnology
13/5, Korgalzhyn rd., Astana, 010000, Kazakhstan
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

Rabies is an important concern in the Republic of Kazakhstan due to its widespread incidence in the country. The main sources of the disease in the Republic are natural, such as viral transmission through populations of wild carnivores and rodents, and anthropurgic, such as viral transmission through populations of domesticated animals. The ability of rabies virus to spread rapidly underscores the importance of developing diagnostic measures during both prevention and quarantine efforts as these could be used to quell emerging out breaks. With the increase in the rate of diagnostic method development, problems have arisen with the inconsistency of antigens and antibodies used to develop diagnostic test systems. The rabies virus nucleoprotein (N protein) is an important target for the immunochemical diagnosis of rabies. Thus, we created a genetic construct based on plasmid pET32 that expresses the С-terminal fragment of the rabies virus nucleoprotein. Our genetic construct was transformed into E. coli competent cells and the parameters of isolation and purification of the recombinant rabies virus nucleoprotein were optimized. We found that the fragment with the most immunogenic site on the nucleoprotein was located at position 360–389 amino acids. The molecular weight of the recombinant antigen was 42 kDa. The serum from mice immunized with fixed rabies virus reacted specifically with this recombinant C-terminal fragment of the nucleoprotein virus. The serum from mice immunized with recombinant antigen and fixed virus showed cross-reactivity at high dilution titers.

Key words: rabies virus, nucleoprotein, recombinant antigen, genetic construct, immunogenic domain, producing strains


 

ВВЕДЕНИЕ

Вирус бешенства (rabies virus) является представителем семейства Rhabdoviridae, рода Lyssavirus и известен своим тропизмом к клеткам нервной системы. Почти у всех млекопитающих и человека вирус вызывает энцефалит с тяжелыми неврологическими симптомами. Геном вируса представляет собой одноцепочную минус-РНК и состоит из пяти участков, ответственных за синтез нуклеопротеина (N), фосфопротеина (P), матричного (M) белка, гликопротеина (G) и большого (L) белка [1].

Нуклеопротеин является важным внутренним компонентом вируса, участвующим в формировании рибонуклеопротеина. Рекомбинантные нуклеопротеины вируса бешенства с полноразмерными РНК клеток, формировали структуры, идентичные вирусным нуклеокапсидам. Эти структуры обладали такой же стехиометрией, как и вирусные нуклеокапсиды: 9 нуклеотидов на один мономер. Более того, полученные структуры обладали одинаковым с нуклеокапсидом вирусов коэффициентом плотности и чувствительностью к протеазе и РНКазе [2]. При этом посттрансляционные модификации антигена не оказывали значимого влияния на формирование рибонуклеопротеина [3].

Помимо указанных выше свойств, нуклеопротеин высоко консервативен и может выполнять роль целевого антигена при диагностике и идентификации вируса [4]. Анализ 30 образцов вирусов, выделенных в Индии, показал, что все вирусы по данному антигену относятся к одному кластеру. Было показано, что нуклеопротеин обладает специфическими антигенными детерминантами, характерными для всех вирусов бешенства и даже родственных вирусов. При использовании специфических моноклональных антител к нуклеопротеину было выявлено наличие целого ряда специфических антигенных сайтов [5]. На нуклеопротеине штамма ERA выявлены три независимых антигенных сайта [6]. Некоторые эпитопы белка были картированы и находились в небольшой области, длинной от 10 до 25 аминокислот [7]. По результатам других работах, нуклеопротеин штамма RC-HL имеет, по крайней мере, четыре антигенных сайта (I-IV), при этом сайты I и IV и II и III состоят из нескольких линейных и конформационных эпитопов, соответственно [8].

Немаловажное значение имели мутации антигена, оказавшие влияние на его функции и свойства. Отмечено, что мутации в различных участках нуклеопротеина могут усиливать патогенность вируса. Tatsunori M. с соавторами (2011), изучая аминокислотную последовательность нуклеопротеинов патогенного штамма Nishigahara и непатогенного штамма Nishigahara-CE, выявили замены по трем аминокислотам (Phe на Leu в положении 273, Tyr на His в положении 394 и Phe на Leu в положении 395). Данные замены, одна или в комбинации, приводят к усилению патогенности вируса и блокированию иммунитета. Авторами выявлено, что наиболее значимыми мутациями, позволяющими вирусу блокировать антивирусный иммунитет и повысить патогенность, являются мутации в положениях 273 и 394 [9].

Хотя очищенные нуклеопротеины вируса бешенства не индуцируют образование вируснейтрализующих антител, они способны формировать защитный иммунитет. По литературным данным, иммунологическая защита может быть индуцирована вакцинацией животных только нуклеопротеином вируса [10]. Учитывая важность нуклеопротеина в репликации вируса, в настоящее время уделяется большое внимание использованию как самого нуклеопротеина, так и специфических к нему антител в диагностике бешенства. Shigeji Katayama с соавторами (1998) разработали иммуноферментный анализ, используемый как контролирующий тест при производстве вакцины. Иммуноферментный анализ предназначался для обнаружения нуклеопротеина и рибонуклеопротеина в вакцине против бешенства [11].

В этой статье опубликованы исследования по изучению антигенных и диагностических характеристик рекомбинантного С-концевого фрагмента нуклеопротеина вируса бешенства, содержащего линейный антигенный сайт в позиции 360-389 аминокислот.

 

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Штаммы микроорганизмов, плазмиды, питательные среды, олигонуклеотиды

В работе использованы штаммы Е. coli DH5cc и BL21, плазмидные вектора pGEM-TEasy и pET32. Клетки E. coli выращивали на жидкой и плотной питательной среде LB с добавлением ампициллина.

Олигонуклеотиды, использованные для получения кодоноптимизированного гена нуклеопротеина вируса бешенства, представлены в таблице 1.

 

Таблица 1 – Нуклеотидная последовательность синтезированных олигомеров
Table 1 – Nucleotide sequences of syntheses oligomers 

п.п

Нуклеотидная последовательность

Размер олигомера, п.н.

N1

gaagaagaaattcgccgcatgtttgaaccgggccaggaaaccgcggtgccgcatagctat 

60

N2

cgggcttttgccgctcaggcccaggctgcgaaaatgaataaaatagctatgcggcaccgc 

60

N3

gagcggcaaaagcccgtatagcagcaacgcggtgggccatgtgtttaacctgattcattt 

60

N4

ttcaggctgcgcacctggcccatatagcagcccacaaaatgaatcaggttaaacacatgg 

60

N5

aggtgcgcagcctgaacgcgaccgtgattgcggcgtgcgcgccgcatgaaatgagcgtgc 

60

N6

aggtgcctttgccaaaaaattcttcgcccagatagccgcccagcacgctcatttcatgcg 

60

N7

aattttttggcaaaggcacctttgaacgccgcttttttcgcgatgaaaaagaactgcagg 

60

N8

gcgccacatcggttttggtcagttccgccgcttcatgttcctgcagttctttttcatcgc 

60

N9

ccaaaaccgatgtggcgctggcggatgatggcaccgtgcatagcgatgatgaagattatt 

60

N10

tatacaccgcttccgggctgcgggtttcgccgctaaaataatcttcatcatcgctatgca 

60

N11

gcccggaagcggtgtatacccgcattatgatgaacggcggccgcctgaaacgcagccata 

60

N12

ggcgcgcctgatggttgctgctcacgctcacatagcggcgaatatggctgcgtttcaggc 

60

N13

accatcaggcgcgcccgaacagctttgcggaatttctgaacaaaacctatagcaacgata 

60

N14

ccacaagcttctcgagttagctatcgttgctataggttttgttcag 

46

forN

gggccaggaaaccgcggtgccgcatag

27

stop N

ccacaagcttctcgagttagctatcg

26

 

Получение генетической конструкции, несущей ген С-концевого фрагмента нуклеопротеина вируса бешенства

Синтез гена антигенного сайта нуклеопротеина вируса бешенства 4 концевыми сайтами рестрикции проводили в условиях de novo полимеразной цепной реакции с использованием Phusion полимеразы. Разделение фрагментов ДНК проводили согласно Маниатису и др. [12] методом электрофореза в горизонтальных агарозных гелях с концентрацией агарозы от 1 до 3%. Препаративное разделение фрагментов ДНК проводили в 0,8% агарозном геле. Фрагмент ДНК экстрагировали смесью фенол-хлороформ и хлороформом, после чего преципитировали этанолом.

Для лигирования фрагментов ДНК использовали ДНК-лигазу фага Т4. Гидролиз плазмидной ДНК проводили с использованием эндонуклеаз рестрикции NdeI, XhoI и BamHI (Fermentas, Литва) в соответствующих буферных и температурных условиях согласно рекомендациям производителей.

Трансформацию клеток лабораторных штаммов E. coli DH5cc и XLBlue проводили по методу Hanahan [13]. Первичную структуру ДНК определяли по методу Sanger [14] с использованием наборов BigDye на автоматических анализаторах ДНК ABI Prism 3100 (Applied Biosystems, США).

 

Вестерн-блот, иммуноферментный и иммунохроматографический анализ рекомбинантного С-концевого фрагмента нуклеопротеина

Определение иммунохимических характеристик С-концевого фрагмента нуклеопротеина вируса проводили с использованием Вестерн-блота [15] и непрямого варианта иммуноферментного анализа. В качестве первых антител использовали поликлональные антитела мышей, иммунизированные инактивированным вирусом. Образующийся комплекс антиген-антитело выявляли антивидовым конъюгатом. Определение диагностических характеристик полученного протеина проводили методом иммунохроматографического и иммуноферментного анализа с использованием сывороток от больных и вакцинированных животных.

 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

В результате проведенных работ в условиях de novo синтезирован кодон оптимизированный ген С-концевого фрагмента нуклеопротеина вируса бешенства. Сиквенирование полученного фрагмента гена показало полное совпадение с планируемой нуклеотидной последовательностью. Полученный фрагмент гена клонирован в экспрессионную плазмиду рЕТ32 (рисунок 1). С целью получения рекомбинантного фрагмента нуклеопротеина полученная генетическая конструкция была трансформирована в клетки E. coli штамма BL21.

Рис. 1. Схема плазмиды pET32/frag NP RV, несущей ген С-концевого фрагмента нуклеопротеина вируса бешенства  
Fig. 1. Map of pET32/frag NP RV plasmid having gen of C-terminal fragment of the rabies virus nucleoprotein 
 
Рис. 1. Схема плазмиды pET32/frag NP RV, несущей ген С-концевого фрагмента нуклеопротеина вируса бешенства  
Fig. 1. Map of pET32/frag NP RV plasmid having gen of C-terminal fragment of the rabies virus nucleoprotein 

 

В литературе описаны различные варианты синтеза гена нуклеопротеина вируса бешенства. Gato H. с соавторами (1995) синтезировали участок нуклеопротеина вируса бешенства штамма RC-HL длинной 519 пар оснований, несущего гены наиболее антигенных эпитопов [16]. Khadijeh Fanayi с соавторами (2014) при разработке системы эукариотической экспрессии синтезировали ген нуклеопротеина вируса штамма PV [17]. Xiangping Yin с соавторами (2013) синтезировали полноразмерный ген нуклеопротеина вируса бешенства штамма ERA [18]. Отличительная особенность данной работы от описанных в литературе способов заключалась в получении гена нуклеопротеина, оптимизированного для прокариотической системы экспрессии.

В результате экспрессии, выделения и очистки рекомбинантного фрагмента нуклеопротеина вируса получен белок с молекулярной массой 42 кДа (рисунок 2). При этом количество получаемого продукта, согласно электрофореграмме, составило около 25% от всех клеточных белков. 

Рис. 2. SDS-PAGE анализ индукции рекомбинантного С-концевого фрагмента нуклеопротеина вируса бешенства
1 – осадок клеточного лизата; 2 – надосадочная жидкость клеточного лизата; 3 – клеточный лизат; 4 – молекулярный маркер

Fig. 2. SDS-PAGE analysis induction of the recombinant C-terminal fragment of the rabies virus nucleoprotein 
1 – pellet of cell lysate; 2 – supernatant of cell lysate; 3 – cell lysate; 4 – molecular marker
 
Рис. 2. SDS-PAGE анализ индукции рекомбинантного С-концевого фрагмента нуклеопротеина вируса бешенства
1 – осадок клеточного лизата; 2 – надосадочная жидкость клеточного лизата; 3 – клеточный лизат; 4 – молекулярный маркер

Fig. 2. SDS-PAGE analysis induction of the recombinant C-terminal fragment of the rabies virus nucleoprotein 
1 – pellet of cell lysate; 2 – supernatant of cell lysate; 3 – cell lysate; 4 – molecular marker

 

Для подтверждения наличия гексагистидиновой метки проводили иммуноблот с использованием анти-полиHis моноклональных антител (рисунок 3). Иммуноблот показал, что моноклональные антитела специфически реагируют с предполагаемым белком. 

Рис. 3. Иммуноблот и SDS-PAGE анализ рекомбинантного С-концевого фрагмента нуклеопротеина вируса бешенства
А – иммуноблот с использованием анти-полиHis моноклональными антителами; В – SDS-PAGE анализ клеточного лизата, обработанного различными концентрациями мочевины; 1 – препарат без обработки мочевиной; 2 – после 1М мочевины; 3 – после 8М мочевины; 4 – молекулярный маркер

Fig. 3. Western blot and SDS-PAGE analysis of C-terminal fragment of the rabies virus nucleoprotein
A – western blot with use anti-polyHis monoclonal antibody; B – SDS-PAGE analysis of cell lysate treated with different concentration urea; 1 – cell lysate without treatment urea; 2 – after 1 M urea; 3 – after 8M urea; 4 – molecular marker
 
Рис. 3. Иммуноблот и SDS-PAGE анализ рекомбинантного С-концевого фрагмента нуклеопротеина вируса бешенства
А – иммуноблот с использованием анти-полиHis моноклональными антителами; В – SDS-PAGE анализ клеточного лизата, обработанного различными концентрациями мочевины; 1 – препарат без обработки мочевиной; 2 – после 1М мочевины; 3 – после 8М мочевины; 4 – молекулярный маркер

Fig. 3. Western blot and SDS-PAGE analysis of C-terminal fragment of the rabies virus nucleoprotein
A – western blot with use anti-polyHis monoclonal antibody; B – SDS-PAGE analysis of cell lysate treated with different concentration urea; 1 – cell lysate without treatment urea; 2 – after 1 M urea; 3 – after 8M urea; 4 – molecular marker

 

Для дальнейшей очистки рекомбинантного антигена использовали металлхелатную хроматографию (рисунок 4). Анализ электрофореграммы очищенных препаратов рекомбинантного протеина показал, что наиболее концентрированный выход антигена из колонки наблюдается при элюции антигена 100 мМ имидазолом. 

Рис. 4. SDS-PAGE анализ очищенных препаратов рекомбинантного С-концевого фрагмента нуклеопротеина вируса бешенства
ММ – молекулярный маркер; 1, 2 – проба, прошедшая через колонку; 3, 4 – промывка колонки; 5 – антиген после обработки колонки 100 мМ имидазолом; 6-8 – антиген после обработки колонки 200 мМ имидазолом; 9 – антиген после обработки колонки 500 мМ имидазолом

Fig. 4. SDS-PAGE analysis of cleaned product of recombinant C-terminal fragment of the rabies virus nucleoprotein
MM – molecular marker; 1, 2 – product passed through the column; 3, 4 – wash of column; 5 – antigen after treatment column by 100 mM imidazole; 6-8 – antigen after treatment column by 200 mM imidazole; 9 – antigen after treatment column by 500 mM imidazole
 
Рис. 4. SDS-PAGE анализ очищенных препаратов рекомбинантного С-концевого фрагмента нуклеопротеина вируса бешенства
ММ – молекулярный маркер; 1, 2 – проба, прошедшая через колонку; 3, 4 – промывка колонки; 5 – антиген после обработки колонки 100 мМ имидазолом; 6-8 – антиген после обработки колонки 200 мМ имидазолом; 9 – антиген после обработки колонки 500 мМ имидазолом

Fig. 4. SDS-PAGE analysis of cleaned product of recombinant C-terminal fragment of the rabies virus nucleoprotein
MM – molecular marker; 1, 2 – product passed through the column; 3, 4 – wash of column; 5 – antigen after treatment column by 100 mM imidazole; 6-8 – antigen after treatment column by 200 mM imidazole; 9 – antigen after treatment column by 500 mM imidazole

 

Подобная методология использована при получении рекомбинантного нуклеопротеина вируса бешенства штамма CTN [19]. В качестве экспрессионного вектора и потенциального продуцента антигена авторы использовали плазмиду pMal-c2x и клетки E. coli штамма JM109, соответственно. По данным авторов, экспрессия белка в E. coli обладала значительным преимуществом в сравнении с традиционным методом выделения и очистки нуклеопротеина и вируса из культуры клеток. Количество полученного рекомбинантного нуклеопротеина в прокариотических клетках составляло 25% от всех клеточных белков.

Gato H. с соавторами (1995), при исследовании структуры антигенных эпитопов I и IV нуклеопротеина вируса бешенства, клонировали кДНК нуклеопротеина штамма RC-HL в экспрессионный вектор рЕТ3а и трансформировали в кишечную палочку BL21 (DE3) [16]. Первоначально авторы методом полимеразной цепной реакции синтезировали участок нуклеопротеина вируса бешенства длинной 519 пар оснований, несущих гены этих антигенных эпитопов. Полученный фрагмент встраивался в полноразмерный фрагмент кДНК нуклеопротеина. Этим же методом получали конструкции, несущие заданные мутации в этих регионах.

Необходимо отметить, что технология получения рекомбинантных белков в E. coli эффективно используется для наработки антигенов различных вирусов и вирусоподобных частиц [20, 21, 22, 23]. Помимо вирусных антигенов, данная технология широко применяется для получения биологически активных молекул, таких как полимеразы, фосфогидролазы и фитазы [24, 25, 26, 27].

Для синтеза в условиях de novo гена С-концевого фрагмента нуклеопротеина использована аминокислотная последовательность нуклеопротеина вируса бешенства, выделенного в Монголии. Сравнительный анализ аминокислотной последовательности нуклеопротеина показал полное соответствие между нуклеопротеинами различных штаммов вируса и полученного рекомбинантного протеина (рисунок 4). Интерес к данному участку протеина связан с наличием двух линейных антигенных эпитопа. По данным Gato H. и соавторов (1995), участок длиной в 24 аминокислоты обладал наиболее высокой иммуногенностью, характерной для большинства штаммов Lyssavirus, и находился в позиции от 360 до 389 аминокислоты [16].

Рис. 5. Сравнительный анализ аминокислотной последовательности нуклеопротеина вируса бешенства различных изолятов
Fig. 5. Comparative analysis of amino acid sequences of the rabies virus nucleoprotein different isolates
 
Рис. 5. Сравнительный анализ аминокислотной последовательности нуклеопротеина вируса бешенства различных изолятов
Fig. 5. Comparative analysis of amino acid sequences of the rabies virus nucleoprotein different isolates

 

С целью определения антигенных свойств полученного фрагмента проведены исследования с использованием специфической гипериммунной сыворотки. Для получения специфической сыворотки мышей линии BALB/c иммунизировали полученным фрагментом нуклеопротеина и фиксированным вирусом бешенства по двухнедельной схеме. Полученные от иммунизированных мышей сыворотки использовали в иммуноблоте и иммуноферментном анализе. По результатам иммуноблота видно, что в сыворотке иммунизированных фиксированным вирусом мышей присутствуют антитела против С-концевого фрагмента нуклеопротеина вируса бешенства (рисунок 6).

Рис. 6. Иммуноблот рекомбинантного фрагмента нуклеопротеина с сывороткой мышей, иммунизированных фиксированным вирусом бешенства
Fig. 6. Western blot of the recombinant fragment nucleoprotein with serum of mouse immunized rabies virus-fixed
 
Рис. 6. Иммуноблот рекомбинантного фрагмента нуклеопротеина с сывороткой мышей, иммунизированных фиксированным вирусом бешенства
Fig. 6. Western blot of the recombinant fragment nucleoprotein with serum of mouse immunized rabies virus-fixed

 

Для определения уровня антител против С-концевого фрагмента нуклеопротеина в сыворотке мышей, иммунизированной фиксированным вирусом, использовали непрямой вариант иммуноферментного анализа. Иммуноферментный анализ успешно использовался для качественной оценки антител в сыворотке вакцинированных против бешенства собак и кошек [28]. Авторами было показано, что результаты иммуноферментного анализа коррелировали с результатами реакции иммунофлуоресценции. В результате проведенных исследований было выявлено, что антитела против С-концевого фрагмента нуклеопротеина вируса в сыворотке иммунизированных мышей отмечались в разведении 1:6400 (рисунок 7). Оптическая плотность реакции составила 1,500 при длине волны 492 нм.

Рис. 7. Иммуноферментный анализ рекомбинантного антигена и фиксированного вируса бешенства
ПС1 – сыворотка мыши, иммунизированной рекомбинантным С-концевым фрагментом нуклеопротеина вируса бешенства; ПС2 – сыворотка мыши, иммунизированной фиксированным вирусом бешенства; ОС – отрицательная сыворотка

Fig. 7. ELISA of recombinant antigen and rabies virus-fixed
ПС1 – serum of mouse immunized recombinant C-terminal fragment of the rabies virus nucleoprotein; ПС2 – serum of mouse immunized rabies virus-fixed; ОС – negative control serum
 
Рис. 7. Иммуноферментный анализ рекомбинантного антигена и фиксированного вируса бешенства
ПС1 – сыворотка мыши, иммунизированной рекомбинантным С-концевым фрагментом нуклеопротеина вируса бешенства; ПС2 – сыворотка мыши, иммунизированной фиксированным вирусом бешенства; ОС – отрицательная сыворотка

Fig. 7. ELISA of recombinant antigen and rabies virus-fixed
ПС1 – serum of mouse immunized recombinant C-terminal fragment of the rabies virus nucleoprotein; ПС2 – serum of mouse immunized rabies virus-fixed; ОС – negative control serum

 

Из рисунка 7 видно, что по показателям титра антитела и оптической плотности реакция сыворотки с фиксированным вирусом значительно превосходит реакцию с С-концевым фрагментом нуклеопротеина. Противоположенный результат был получен с сывороткой, полученной от мышей, иммунизированных рекомбинантным фрагментом нуклеопротеина. Показатели оптической плотности реакции антител с рекомбинантным антигеном были значительно выше, чем с фиксированным вирусом. В отношении отрицательной контрольной сыворотки необходимо отметить, что в обоих случаях сыворотка демонстрировала отрицательные результаты. Полученные результаты убедительно доказывают возможность использования рекомбинантного С-концевого фрагмента нуклеопротеина вируса бешенства для получения диагностических антител.

По данным авторов, иммунохимические тесты на основе полученного антигена способны заменить реакцию вирус нейтрализации флюоресцентными антителами, применяемыми в серологических исследованиях. Иммунологические методы являются полезными инструментами быстрого скрининга образцов сыворотки от вакцинированных и переболевших животных [29].

 

ВЫВОДЫ

В результате проведенных исследований:

1. Получен рекомбинантный С-концевой фрагмент нуклеопротеина вируса бешенства. Фрагмент несет наиболее иммуногенный сайт нуклеопротеина, расположенный в позиции 360-389 аминокислот. Молекулярный вес рекомбинантного антигена – 42 kDa.

2. Сыворотка мышей, иммунизированных фиксированным вирусом бешенства, специфически реагировала с рекомбинантным С-концевым фрагментом нуклеопротеина вируса.

3. Сыворотка мышей, иммунизированных рекомбинантным антигеном и фиксированным вирусом, показала перекрестную реакцию в высоких титрах разведения.

 

Финансирование

Работа выполнена в рамках проекта «Разработка технологии производства иммуноферментной тест-системы для диагностики бешенства на основе рекомбинантного нуклеопротеина» бюджетной научно-технической программы О.0659 «Промышленные биотехнологии» на 2014-2016 гг., финансируемой Комитетом науки Министерства образования и науки Республики Казахстан.

 

REFERENCES

 

  1. Masatani T., Ito N., Shimizu K., Ito Y., Nakagawa K., Sawaki Y., Koyama H., Sugiyama M. Rabies virus nucleoprotein functions to evade activation of the RIG-I-mediated antiviral response. Journal of Virology, 2010, vol. 84, pp. 4002-4012.
    PubMed
  2. Schoehn G., Iseni F., Mavrakis M., Blondel D., Ruigrok R.W.H. Structure of recombinant rabies virus nucleoprotein-RNA complex and identification of the phosphoprotein binding site. Journal of Virology, 2001, vol. 75, pp. 490-498.
    CrossRef
  3. Kawai A., Toriumi H., Tochikura T.S., Takahashi T., Honda Y., Morimoto K. Nucleocapsid formation and/or subsequent conformational change of rabies virus nucleoprotein (N) is a prerequisite step for acquiring the phosphatase-sensitive epitope of monoclonal antibody 5-2-26. Virology, 1999, vol. 263, pp. 395-407.
    PubMed
  4. Manjunatha Reddy G.B., Singh R., Singh R.P., Singh K.P., Gupta P.K., Desai A., Shankar S.K., Ramakrishnan M.A., Verm R. Molecular characterization of Indian rabies virus isolates by partial sequencing of nucleoprotein (N) and phosphoprotein (P) genes. Virus Genes, 2011, vol. 43, pp. 13-17.
    CrossRef
  5. Flamand A., Wiktor T.J., Koprowski H. Use of hybridoma monoclonal antibodies in the detection of antigenic differences between rabies and rabies-related virus proteins. I. The nucleocapsid protein. Journal of General Virology, 1980, vol. 48, pp. 97-104.
  6. Lafon M., Wiktor T.J. Antigenic sites on the ERA rabies virus nucleoprotein and non-structural protein. Journal of General Virology, 1985, vol. 66, pp. 2125-2133.
    CrossRef
  7. Dietzschotd B., Lafon M., Wang H., Otvos L. Jr., Celis E., Winner W.H., Koprowski H. Localization and immunological characterization of antigenic domains of the rabies virus internal N and NS proteins. Virus Research, 1987, vol. 8, pp. 103-125.
  8. Minamoto N., Tanaka H., Hishida M., Goto H., Ito H., Naruse S., Yamamoto K., Sugiyama M., Kinjo T., Mannen K., Mifune K. Linear and conformation-dependent antigenic sites on the nucleoprotein of rabies virus. Microbiology and Immunology, 1994, vol. 38, pp. 449-455.
    CrossRef
  9. Masatania T., Ito N., Shimizua K., Ito Y., Nakagawa K., Abea M., Yamaoka S., Sugiyama M. Amino acids at positions 273 and 394 in rabies virus nucleoprotein are important for both evasion of host RIG-I-mediated antiviral response and pathogenicity. Virus Research, 2011, vol. 155, pp. 168-174.
  10. Fujii H., Takita-Sonoda Y., Mifune K., Hirai K., Nishizono A., Mannen K. Protective efficacy in mice of post-exposure vaccination with vaccinia virus recombinant expressing either rabies virus glycoprotein or nucleoprotein. Journal of General Virology, 1994, vol. 75, pp. 1339-1344.
  11. Katayama S., Yamanaka M., Ota S., Shimizu Y. A new quantitative method for rabies virus by detection of nucleoprotein in virion using Elisa. Journal of Veterinary Medicine Science, 1998, vol. 61, pp. 411-416.
    CrossRef
  12. Maniatis T., Fritsch E., Sambrook J. Molecularnoe clonirovanie. Metodi geneticheskoi ingenerii [Molecular cloning. A laboratory manual]. Мoscow, Mir, 1982.
  13. Hanahan D. Studies of transformation of Escherichia coli with plasmids. Journal of Molecular Biology, 1983, vol. 166, pp. 557-580.
    PubMed
  14. Sanger F., Nicklen S., Coulson A. DNA sequencing with chain-terminating inhibitors. Proceeding National Academic Science. USA, 1977, vol. 74, pp. 5463-5467.
    PubMed
  15. Towbin H., Staehelin T., Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences USA, 1979, vol. 76. pp. 4350-4354.
  16. Gato H., Minamoto N., Ito H., Luo T.R., Sugiyama M., Kinjo T., Kavai A. Expression of the nucleoprotein of rabies virus in Escherichia coli and mapping of antigenic sites. Archives of Virology, 1995, vol. 140, pp. 1061-1074.
    CrossRef
  17. Fanayi K., Ajorloo M., Mozhgani S.H.R., Irani S., Gholami A. Design, construction and expression of recombinant vector containing the rabies virus nucleoprotein gene. Tehran University Medical Journal, 2014, vol. 72, pp. 294-300.
  18. Yin X., Li Zh., Li J., Yi Y., Zhang Y. et al. Rabies virus nucleoprotein expressed in silkworm pupae at high-levels and evaluation of immune responses in mice. Journal of Biotechnology, 2013, vol. 163, pp. 333-338.
  19. Cao W., He Y., Shi Q., Yang C., Zhang Y. Expression of nucleoprotein gene of CTN strain rabies virus from China in E. coli with antigenicity. Open Journal of Veterinary Medicine, 2013, vol. 3, pp. 309-313.
    CrossRef
  20. Khassenov B., Sultanculov B.M., Kozhakhmetov S.S., Akhmetov B.S., Ramanculov E.M., Mukanov K.K. Poluchenie recombinantnogo antigena virusa leicoza krupnogo rogatogo scota p24 [Producing recombinant antigen of the virus of bovine leukemia p24]. Biotechnology: theory and practice, 2011, no. 2, pp. 50-56.
  21. Kamzina A.S., Baltabekova A.Zh., Shustov A.V. Virus-like particles presenting conformational epitopes as a promising vaccine platform. Biotechnology: theory and practice, 2012, no. 4, pp. 3-9.
  22. Kamzina A.S., Baltabekova A.Zh., Shustov A.V. Effectivniy metod poluchenia virusopodobnikh chastic, nesuschikh epitopi immunoglobulina cheloveka [Efficient method of producing virus-like particles carrying epitopes of human immunoglobulin]. Biotechnology: theory and practice, 2013, no. 3, pp. 20-25.
  23. Калиева М.Ж., Baltabekova A.Zh., Shustov A.V. Poluchenie i characterizacia recombinantnikh epitopnikh antigenov ischura epizooticheski actualnikh for Kazakhstan serotipov J, , Asia-1 [Obtaining and characterization of recombinant epitope antigens of the FMD epizootic topical for Kazakhstan serotypes O, A, Asia-1]. Biotechnology: theory and practice, 2014, no. 4, pp. 44-52.
  24. Abeldenov S., Khassenov B. Cloning, expression and purification of recombinant analog of Taq DNA polymerase. Biotechnology. Theory and Practice, 2014, no. 1, pp. 12-16.
  25. Mussakhmetov A., Nurmagambetova A., Abeldenov S., Khassenov B. Purification of recombinant Pfu DNA polymerase by double step affinity chromatography. Biotechnology. Theory and Practice, 2014, no. 2, pp. 42-47.
  26. Abeldenov S., Kirillov S., Kiribayeva A., Silayev D., Khassenov B. Expression, purification and biochemical characterization of recombinant phosphohydrolase AppA in Escherichia coli. Biotechnology. Theory and Practice, 2014, no. 3, pp. 61-65.
  27. Evtikhova E.B., Silaev D.V., Baltabekova A.Zh., Shustov A.V. Termostabilnai recombinantnai phytase proizvedennai v E. coli [Thermostable recombinant phytase produced in E. coli]. Biotechnology: theory and practice, 2014, no. 1, pp. 62-70.
  28. Jiang Y., Luo Y., Michel F., Hogan R.J., He Y., Fu Zh.F. Characterization of conformation-specific monoclonal antibodies against rabies virus nucleoprotein. Archive Virology, 2010, vol. 155, pp. 1187-1192.
  29. Inoue S., Motoi Y., Kashimura T., Ono K., Ya-mada A. Safe and easy monitoring of anti-rabies anti-body in dogs using His-tagged recombinant N-protein. Japanese Journal of Infectious Diseases, 2003, vol. 56, pp. 158-160.
    PubMed

 

ҚҰТЫРУ ВИРУСЫ НУКЛЕОПРОТЕИНІНІҢ РЕКОМБИНАНТТЫ ИММУНОГЕНДІК ДОМЕНІН АЛУ

 

Турсунов Қ., Бегалиева А., Інірбай Б., Муқанов Қ.К., Раманкулов Е.М., Шустов А.В., Муқантаев Қ.Н.
Ұлттық биотехнология орталығы
Коргалжын тас жолы, 13/5, Астана, 010000, Қазақстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Кең таралуына байланысты құтыру қазіргі таңда Қазақстан Республикасы үшін өзекті мәселе болып табылады. Республика аумағында аурудың негізгі көздері екі түрлі таралу ошақтары: табиғи, оларда вирус негізінде жабайы жыртқыштар мен  кеміргіштер популяцияларында  сақталып тұрады, антропургиялық ошақтары, оларда вирустың айналысы үй жануарларының популяциясында жүзеге асырылады.  Вирустың жылдам таралуға қабілеттілігі профилактикалық және карантиндік іс-шаралар жүйесіндегі  диагностикалық зерттеулердің маңызды рөл атқаратындығын анықтайды. Диагностикалық әдістерді дамыту қарқындылығының артуына байланысты  антигендердің және антиденелердің әзірленетін тест-жүйелерінің деңгейіне сәйкес келмеу мәселелері туындады. Құтыру вирусы нуклеопротеинінің жекелеген бөліктерінің диагностикалық рөліне қазіргі кезде барынша назар аударылуда. Жүргізілген зерттеулердің нәтижесінде құтыру вирусы нуклеопротеинінің  С-соңғы фрагментін экспрессиялайтын генетикалық құрылым құрылды. Алынған генетикалық құрылым E.coli компетенттік жасушаларға енгізілді. Құтыру вирусының рекомбинантты нуклеопротеинін бөлу және тазарту параметрлері әзірленді.  Фрагмент 360-389 аминоқышқылдар позициясында  орналасқан нуклеопротеиннің неғұрлым иммуногенді сайты қызметін атқарады. Рекомбинантты антигеннің молекулалық салмағы 42 кДа. Алынған вирустың нуклеопротеиннің рекомбинантты С-сонғы фрагментімен белгілінген құтыру вируспен иммундылғаң тышқан сарысуымен арнайы реакцияны көрсетті. Рекомбинантты антигенмен және белгіленген вируспен иммундалған тышқандардың сарысулары өсірудің жоғары титрларында айқыш реакция көрсетті.     

Негізгі сөздер: құтыру вирусы, нуклеопротеин, рекомбинантты антиген, генетикалық құрылым, иммуногенді домен, штамм-продуцент.