2/2017
Khapilina O.N.1, Daniyarov A.Z.1, АmenovА.А.1, Novakovskaya А.P.1, ТurzhanovaА.S.1, Тagimanova D.S.1, Filippova N.I.2, Каlendar R.N.1
National Center for Biotechnology
1National Center for Biotechnology
13/5, Korgalzhyn hwy, Astana,  Kazakhstan
Scientific-Production Center of Grain Farming named after A.I. Barayev, Akmola reg., Kazakhstan

 

ABSTRACT

Retrotransposon-based molecular markers were used to assess variation in the perennial legumes alfalfa, sweet clover, and lupin from local (Kazakhstan) and world gene pools. Specific retrotransposons were found for species in the Fabaceae family. Conserved regions of LTR retrotransposon sequences were used to design PCR primers to detect polymorphisms by the IRAP method. Universal primers for retrotransposon primer binding site (PBS) sequences were also used. A preliminary screen was used to select the most informative primers that identified up to 80% of polymorphisms. Cluster analysis was carried out to quantify polymorphism and divergence. LTR primers can be used for the simultaneous detection of polymorphic loci that are distributed evenly across the genome. In addition, the study of genetic polymorphism using retrotransposons is distinguished with availability and informative of the method. LTR retrotransposons were employed to study genetic variability and were able to separate the perennial legume varieties according to their relationships and genetic diversity. The results obtained using this method provides a basis for better control of germplasm, future systematic studies, and genetic improvement. This method can also be applied to thestudy of the role of retrotransposons in the genetic variability of species and the dynamics of their genomes.

Keywords: perennial legumes, molecular markers, iPBS, retrotransposons, genotyping.
Abbreviations: LTR, long terminal repeat; PBS, primer binding site; IRAP, inter-retrotransposon amplified polymorphism; REMAP, Retrotransposon microsatellite amplified polymorphism; iPBS, inter-primer binding site polymorphism.

 

УДК 633.366:575.17:577.21

 

ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОГО ПОЛИМОРФИЗМА МНОГОЛЕТНИХ  БОБОВЫХ ТРАВ  C ИСПОЛЬЗОВАНИЕМ МОЛЕКУЛЯРНЫХ МАРКЕРОВ  НА ОСНОВЕ РЕТРОТРАНСПОЗОНОВ

 

Хапилина О.Н.1, Данияров А.Ж.1, Аменов А.А.1, Новаковская А.П.1, Туржанова А.С.1, Тагиманова Д.С.1, Филиппова Н.И.2, Календарь Р.Н.1
1Национальный центр биотехнологии
Кургальжинское шоссе, 13/5, Астана, Казахстан
2Научно-производственный центр зернового хозяйства им. А.И. Бараева, Акмолинская обл., Казахстан
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

АБСТРАКТ

Для многолетних бобовых трав (люцерна, донник, люпин, клевер) были применены молекулярные маркеры на основе последовательностей ретротранспозонов для оценки внутривидовой изменчивости среди образцов отечественного и мирового генофонда. Для растений семейства Fabaceae нами были найдены специфические ретротранспозоны. Консервативные последовательности из LTR для растений семейства Fabaceae были применены при подборе ПЦР праймеров для детекции полиморфизма методом IRAP. Кроме того, были использованы универсальные праймеры, комплементарные последовательностям PBS участков для LTR ретротранспозонов. По результатам амплификации были выбраны наиболее информативные праймеры, спектры амплификации которых были с наиболее контрастными ампликонами, выявляющие до 80% полиморфизма. Для количественной оценки полиморфизма и определения степени дивергенции был проведен кластерный анализ. Исследования показали, что разработанные LTR праймеры являются эффективными для использования вследствие одновременной детекции полиморфизма множества локусов, которые равномерно распределены в геноме. Кроме того, исследование генетического полиморфизма с использованием ретротранспозонов отличается доступностью и информативностью метода. Генетическая изменчивость, исследованная с использованием LTR ретротранспозонов, позволила разделить сорта многолетних бобовых трав соответственно их родству и генетическому разнообразию. Результаты исследований, полученные с использованием данного метода, обеспечивают основу для лучшего управления зародышевой плазмой, будущих систематических исследований и генетического улучшения, а также для исследования роли ретротранспозонов в генетической изменчивости видов и динамики их геномов.

Ключевые слова: многолетние бобовые травы, молекулярные маркеры, iPBS, ретротранспозоны, генотипирование
Аббревиатура: LTR (Long Terminal Repeat); PBS (Primer Binding Site); IRAP (Inter Retrotransposone Amplified Polymorphism); REMAP (Retrotransposone Microsatellite Amplified Polymorphism); iPBS (Inter- Primer Binding Site Polymorphism) 


ВВЕДЕНИЕ

По прогнозам ФАО, численность населения Земли увеличится в 2 раза, это повлечет за собой возрастание спроса на продукты питания, что скажется на окружающей среде и продовольственной безопасности. В этой связи возрастает значение бобовых культур, которые имеют определяющее значение в обеспечении населения пищевыми продуктами, создании полноценной кормовой базы, фиксации биологического азота и улучшении физического состояния почв. Растения семейства Бобовых (Fabaceae) занимают второе место после злаковых (Poaceae), составляя 27% мирового производства, и обеспечивая 33% диетического белка [1].

Как показывает анализ развития кормопроизводства, в последнее время наблюдается снижение продуктивности кормовых угодий, это усугубляется в годы с неустойчивым увлажнением. Также остро стоит проблема увеличения содержания кормового белка в рационе животных. Решающая роль в обеспечении животноводческой отрасли высококачественными кормами принадлежит многолетним бобовым травам, основные виды - люцерна, эспарцет, донник, клевер составляют до 70% кормопроизводства, и используются для получения сена, сенажа, витаминно-травяной муки и зеленого корма в летний период. В перспективе планируется увеличение посевных площадей за счет многолетних бобовых трав, выгодных экономически и энергетически [2]. Коэффициент энергетической эффективности многолетних трав в 2-2,5 раза выше в сравнении с зернофуражными культурами. По качеству кормового белка и содержанию незаменимых аминокислот (лизина, лейцина, гистидина и триптофана) многолетние бобовые травы значительно превосходят другие кормовые культуры. Кроме того, многолетние бобовые травы, в отличие от однолетних культур, отличаются продуктивностью, долголетием и многоцелевым использованием [3].

Несмотря на ценные агротехнические достоинства многолетних бобовых трав, валовый их сбор не обеспечивает потребности животноводческой отрасли сельского хозяйства, что обусловлено воздействием стрессовых факторов (абиотических и биотических), а также низкой продуктивностью семян. В этой связи остро стоит проблема раширения генофонда многолетних бобовых трав, привлечения современных методов селекции, а также молекулярной биологии, биотехнологии для создания сортов, отвечающих требованиям интенсивного земледелия. Как правило, для создания новых сортов с улучшенными характеристиками применяется фенотипический отбор с последующей рекомбинацией генетических вариаций. В большинстве случаев селекционер работает со сложными признаками, которые контролируются большим количеством генов, а их фенотипическое проявление существенно варьирует в зависимости от условий внешней среды. В связи с этим суждение о генетической ценности материала, основанное на фенотипическом проявлении его признаков и свойств, в определённой степени ошибочно. С развитием современных методов селекции и созданием широкого сортового разнообразия культур возникли также определённые трудности в методиках достоверной идентификации сортов растений. Используемые для этой цели морфологические характеристики не всегда достаточны для маркирования и паспортизации сортов. В связи с этим поиск эффективных способов изучения исходного материала и отбора перспективных форм является актуальным [4].

Для выяснения степени родства на внутривидовом и межвидовом уровнях широко используются различные ДНК-маркерные системы, из которых наиболее доступны и эффективны RAPD, ISSR, SSR [5, 6]. Данные типы маркеров, характеризующиеся относительно высокой частотой встречаемости в геноме, широко используются в селекционно-генетических исследованиях, что привело к развитию маркерной селекции (marker-assisted selection) и «молекулярной паспортизации сортов». Имеются работы, в которых используются универсальные последовательности генов для хлоропластного генома, для выявления полиморфизма, идентификации материнских или отцовских аллелей, филогенетических исследований, однако, низкая плотность покрытия генома не позволяет использовать их для сравнения количественных данных [7].

В последнее время интенсивно стали использоваться технологии фингерпринта на основе ПЦР к последовательностям повторов, таким как ретротранспозоны, потенциально мобильным генетическим элементам, которые составляют основную часть генома растений (у всех эукариот). Вследствие значительной диспергированности в геноме, ретротранспозоны играют важную роль в эволюции видов. Ретротранспозоны потенциально могут перемещаться в геноме растений по принципу «копирование и вставки», как ретровирусная инфекция, синтезируя вирусную копию РНК. Вставка ретротранспозона вблизи гена может существенно влиять на его экспрессию, в случае встраивания ретротранспозона внутри самого гена может непосредственно измениться его генная структура и функции, что может привести к образованию мутаций [7].

Длинные концевые повторы (LTR) ретротранспозонов несут регуляторные сайты, опознаваемые некоторыми ядерными факторами. Кроме того, LTR ретротранспозонов участвуют в рекомбинационных процессах, в том числе в митозе и в мейозе, образуя сложные гибриды из разных ретротранспозонов [8].

Ретротранспозоны играют важную роль в растительном геноме, например, у кукурузы они составляют до 75% генома, у представителей семейства Fabaceae могут составлять до 35% [9]. Ретротранспозоны можно разделить на две первичные группы в зависимости от наличия или отсутствия длинного концевого повтора (LTR): ретротранспозоны LTR и не-LTR. LTR ретротранспозоны преобладают в растительных геномах и могут быть использованы в качестве молекулярных маркеров из-за их повсеместного распределения, обильного количества копий, высокой гетерогенности и случайной природы инсерционных полиморфизмов, обусловленных различными группами ретротранспозонов. Последовательности LTR-ретротранспозонов используются для выявления полиморфизма между исследуемыми формами одного вида с помощью ПЦР фингерпринтинга - IRAP, REMAP и SSAP методами [7].

IRAP и REMAP методы широко используются при изучении генетического полиморфизма растений, животных.  В методе IRAP (Inter-Retrotransposon Amplified Polymorphism) используется один или несколько праймеров, комплементарных последовательностям высоко копийных регионов одного ретротранспозона или разных ретротранспозонов. Молекулярные маркеры, которые связаны с ретротранспозонами, расположенными по всему геному, высокополиморфны, позволяют проводить дифференциацию генотипов на межвидовом и внутрисортовом уровнях.

В методе REMAP (Retrotransposon-Microsatellite Amplified Polymorphism) используют любые праймеры, комплементарные высоко-копийной последовательности ретротранспозона в комбинации с любой высоко-копийной последовательностью микросателлита. Микросателлитный праймер имеет последовательность вида (NN)n, (NNN)n или (NNNN)n, где n>5, с дополнительным селективным нуклеотидом на 3’конце праймера, отличным от повторяющейся последовательности. При использовании REMAP маркеров нет ограничений для максимального количества полиморфных участков в одном генотипе, в отличие от SSR маркеров, потому что вставки ретротранспозона независимы друг от друга [7].

В отличие от предыдущих методов, iPBS-метод для «случайной» амплификации ДНК начали использовать относительно недавно. Широкое использование ретротранспозонов в качестве молекулярных маркеров лимитируется недостаточностью для разработки праймеров данных о последовательности нуклеотидов в области LTR ретротранспозонов из конкретного генома. При отсутствии априорной информации, LTR последовательности должны быть клонированы и секвенированы. Метод амплификации ДНК между PBS последовательностями (iPBS амплификация), позволяет преодолеть эту проблему, используя консервативные области последовательностей PBS сайтов ретротранспозонов, как для выявления полиморфизма в профилях транскрипции и клонирования LTR сегментов из геномной ДНК, так и для поиска в базах, данных ретротранспозонов.

Амплификация ДНК между PBS последовательностями – это универсальный и эффективный метод, как для непосредственной визуализации полиморфизма между образцами, так и для детекции полиморфизма в транскрипционных профилях, а также для быстрого клонирования сегментов LTR из геномной ДНК и алгоритма поиска по базе данных LTR-ретротранспозонов. Данный метод iPBS-амплификации основан на фактически универсальном присутствии тРНК-комплекса в качестве сайта связывания праймеров с обратной транскриптазой как в ретровирусах, так и в LTR-ретротранспозонах, что необходимо для инициации обратной транскрипции во время цикла репликации. Высококонсервативные PBS последовательности характерны для различных семейств LTR ретротранспозонов, и поскольку тРНК связывается с PBS-областью для инициации обратной транскрипции, последовательность этого региона комплементарна последовательности 3'-конца тРНК [7].

Праймеры, разработанные для амплификации консервативных регионов PBS, эффективны для выявления различных классов LTR-ретротранспозонов, в том числе и неавтономных элементов, не имеющих белок-кодирующих регионов, таких как TRIM (Terminal Repeat Retrotransposons Inminiature) и LARD (Large Retrotransposon Derivatives) [10].

Ввиду того, что многие ретротранспозоны являются встроенными в другие ретротранспозоны, и инвертированы друг к другу или фрагментированы, они могут быть доступны при использовании консервативных PBS праймеров в амплификации ДНК, для любого вида растений или животного. Это позволяет использовать данный метод в качестве универсального и высокоэффективного для прямой детекции полиморфизма. Универсальность данного метода определяет его преимущество при проведении ДНК-фингерпринтинга на различных культурах эукариот, относящихся к различным таксономическим единицам.

Метод PBS амплификации был успешно использован при оценке генетической вариабельности ячменя, пшеницы, яблони, кукурузы, льна, винограда, абрикоса, гуавы, пустырника, плюща [11 - 16].

На бобовых растениях данный метод был успешно использован для выявления генетического полиморфизма нута (Cicer sp.). Показано, что генетический полиморфизм видов C. echinospermum и C. pinnatifidum, выявляемый с использованием универсальных iPBS-праймеров достигает 100%, в то время как культурный вид C. arietinum имеет довольно низкий уровень [17].

При использовании iPBS праймеров на фасоли обыкновенной (Phaseolus vulgaris L.) был выявлен высокий уровень полиморфизма среди 67 образцов различного эколого-географического происхождения. Результаты исследований по оценке эффективности данной маркерной системы показали ее успешность для детекции генетического разнообразия [18]. При использовании данного метода на горохе и чечевице также был выявлен высокий уровень полиморфизма, однако на образцах гороха не было выявлено корреляции между общностью спектров амплификации и географическим происхождением образцов [19].

Исследования по разработке молекулярных маркеров и их применению в селекции кормовых культур стали появляться только в последние годы. Они немногочисленны, охватывают не все виды растений, в большинстве случаев нуждаются в оптимизации, разработке системного подхода к ДНК-анализу, и применение результатов в селекционных программах является актуальной научной задачей.

Целью проводимых исследований являлось изучение молекулярно-генетического разнообразия некоторых видов многолетних бобовых трав - донника, клевера, эспарцета и люпина с использованием ПЦР фингерпринта, методами IRAP и iPBS амплификаций.

 

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЙ

В качестве растительных видов многолетних бобовых трав использовались образцы мировой и отечественной коллекций донника (Melilotus sp.), клевера (Trifolium sp.), эспарцета (Onobrychis arenaria), люпина (Lupinus angustifolius).

На сегодняшний день отсеквенировано несколько геномов рода Fabaceae (http://www.comparative-legumes.org/):    соя (http://www.phytozome.net/soybean;   http://soybase.agron.iastate.edu/),  люцерна  (http://www.medicago.org/), лотос (http://www.kazusa.or.jp/lotus/), фасоль-вика (http://beangenes.cws.ndsu.nodak.edu/) (http://www.phytozome.net/Phytozome_resources.php).

Поиск нуклеотидных последовательностей LTR областей ретротранспозонов геномов бобовых для подбора ПЦР праймеров был проведен с использованием поиска LTR-ретротранспозонов для полногеномных последовательностей cеквенированных геномов семейства Бобовых (Fabaceae). Для существующих последовательностей ретротранспозонов из семейства Бобовых (Fabaceae), проводили по электронным базам данных: Repbase (http://www.girinst.org/censor/index.php), NCBI (http://www.ncbi.nlm.nih.gov/guide/dna-rna/), The Legume Information System (http://legumeinfo.org/) и Medicago Genome Database (http://www.plantgdb.org/MtGDB/; http://jcvi.org/medicago/index.php).

Дизайн ПЦР праймеров, in silico ПЦР, анализ олигонуклеотидов производили с помощью программ FastPCR (http://primerdigital.com/fastpcr.html). Эффективность разработанных праймеров оценивали по шкале от 0 до 5, где 0 – праймер не образует ампликонов; 5 – наблюдается наивысшая эффективность: детектируется множество одинаково интенсивных ампликонов [20].

Экстракцию ДНК проводили из проростков методом с использованием кислого лизирующего СТАВ-HEPES буфера в присутствии РНКазы А (1.5% CTAB, 1.5 M NaCl, 10 mM Na3EDTA, 50 mM HEPES, pH 5.3), по протоколу компании PrimerDigital (http://primerdigital.com/dna.html). Качественные и количественные показатели ДНК определяли с использованием гель-электрофореза и спектрофотометра NanoDrop (Thermo Fisher Scientific) (http://www.thermoscientific.com/en/product/nanodrop-lite-spectrophotometer.html).

Экстрагированную ДНК визуализировали с использованием систему гель-документации ChemiDoc-It®TS2 Imager (UVP), для чего проводили горизонтальный электрофорез в 1%-ном агарозном геле, помещенном в камеру с 1хTAE-буфером (40 мМ Tris-CH3COOH, pH 8.0) или 1x THE (20 мМ Tris-HEPES, pH 8.06). Электрофорез проводили при постоянном напряжении 90 V, в течение 60 минут. В качестве маркера молекулярных масс (М) использовали GeneRuler DNA Ladder Mix (100-10,000 bp) (#SM0332, Thermo Fisher Scientific).

Для проведения ПЦР амплификации для ДНК-фингерпринта, использовали реакционную смесь в объеме 25 мкл, следующего состава: ДНК 25 нг, 1x Phire® Hot Start II буфер (содержащий 1.5 mM MgCl2), 0.2-1µM праймер, 200µM dNTP, 0.2 U Phire® Hot Start II ДНК полимеразы (Thermo Fisher Scientific). Режим амплификации был следующим: предварительная денатурация при 98°С в течение 2 минут, затем 32 цикла: 10 сек - 98°C, 30 сек - 50°-60°C и 60 сек - 72°C; последняя элонгация - 2 минуты при 72°C.

Результаты оценивали в 1,2%-ном агарозном геле в 1x THE (20 mM Tris-HEPES, pH 8.06), в присутствии бромистого этидия, с использованием системы гель-документации ChemiDoc-It®TS2 Imager (UVP). Электрофорез проводили при постоянном напряжении 70 V в течение 8-12 часов.

 

РЕЗУЛЬТАТЫ ОБСУЖДЕНИЕ

Создание коллекции многолетних бобовых трав

Генетические коллекции USDA, ВИР, ICRISAT, CIAT и SINGER являются биологической основой мировой продовольственной безопасности. Они содержат разнообразие генетического материала, содержащегося в традиционном многообразии и современных культурных сортах растений, возделываемых наряду с дикорастущими близкими формами культур и прочими другими дикорастущими видами. Кроме того, генетические коллекции являются богатым источником исходного материала для селекции различных сельскохозяйственных культур. В этой связи, важную роль играет начальный этап изучения генетического разнообразия, т.е. формирование коллекции образцов, отражающих все разнообразие как культурных растений, так и их диких сородичей.

В ходе выполнения проекта был проведен поиск сортов, селекционных линий и диких сородичей кормовых бобовых растений – люцерны, клевера, донника, люпина и других культур в коллекциях USDA (http://sun.ars-grin.gov/npgs/), ВИР (http://91.151.189.38/virdb/), и JIC (https://www.jic.ac.uk/germplasm/databases.htm). Также в коллекцию были включены образцы (сорта и гибриды) казахстанской селекции, любезно предоставленные лабораторией селекции многолетних бобовых трав НПЦ ЗХ им. А.И. Бараева.

Образцы сформированной коллекции бобовых трав представлены стародавними и коммерческими сортами и гибридными линиями, а также дикорастущими образцами, собранными в экспедиционных исследованиях (таблица 1).

 

Таблица 1. Коллекция кормовых бобовых трав
Table 1. Collection of forage legumes

Название вида

Name of species

Количество образцов в коллекции

 Number of samples in the collection

Количество образцов в зависимости от биологического состояния
The number of samples depending on the biological state

дикорастущие формы

wild forms

селекционные сорта

breeding varieties

селекционный материал

breeding material

Люцерна

Medicago sativa

109

68

14

27

Клевер

Trifolium sp.

81

35

16

30

Люпин

Lupinus angustifolius

29

20

2

7

Донник

Melilotus sp.

21

5

16

-

 

Люпин узколистный (Lupinus angustifolius) – ценная кормовая культура. Особый интерес к данному виду люпина обусловлен высоким содержанием в его семенах белка (до 50%), масла (5-20%), отсутствием ингибиторов пищеварения и алкалоидов в зеленой массе. Узколистный люпин способен произрастать на бедных песчаных почвах, переносить засуху, обогащать почву фосфором и азотом, использовать макро- и микроэлементы из подпочвы, кроме того, он обладает наивысшей азотфиксирующей способностью среди всех зернобобовых культур. Относительная скороспелость узколистного люпина, в сравнении с другими видами, позволяет успешно возделывать его в северных широтах.

Коллекция люпина узколистного наиболее обширная в географическом отношении – представлена образцами из Австралии, Германии, Испании, Италии, Марокко, России, Турции, Израиля, Португалии, России, Украины, США и Южной Африки. По биологическому состоянию образцы люпина представлены дикими формами (69%), стародавними и коммерческими сортами (7%), у остальных образцов дескриптор отсутствует в базе данных.

Донник (Melilotus sp.) – двухлетнее растение, широко используемое как кормовая культура, отличающаяся засухоустойчивостью, зимостойкостью и высокой урожайностью даже на малопродуктивных и солонцовых почвах. Коллекция представлена тремя видами – донником желтым (M. officinalis), донником белым (M. alba) и донником волжским (M. volgicus). По биологическому состоянию 24% образцов – селекционные сорта, остальные образцы представлены дикорастущими видами из различных регионов Казахстана.

Люцерна (Medicago sp.) – древнейшая кормовая культура, распространенная повсеместно, род насчитывает около 50 видов. В сельскохозяйственном производстве используется в основном люцерна синяя или посевная (M. sativa). Коллекция люцерны наиболее многочисленная, охватывает 57 стран. 31% образцов представлено дикарями, 39% - стародавние и современные коммерческие сорта, у остальных нет информации по данному дескриптору. Образцы, формирующие коллекцию, являются, в основном, представителями естественных популяций из Казахстана, северных провинций Китая, Монголии и России, а также имеется несколько коммерческих сортов отечественной селекции.

Клевер (Trifolium sp.) – перспективная кормовая культура, в коллекции представлены образцы, относящиеся к 3 видам: T. pratense, T. repens и T. hybridum, большинство образцов по биологическому состоянию относятся к дикорастущим образцам (43%), традиционные и стародавние сорта составляют около 20%.

 

Поиск последовательностей ретротранспозонов и дизайн ПЦР праймеров

Поиск нуклеотидных последовательностей LTR областей ретротранспозонов геномов бобовых для подбора ПЦР праймеров был проведен с использованием поиска LTR-ретротранспозонов для полногеномных последовательностей cеквенированных геномов семейства Бобовых (Fabaceae). Проведенный анализ доступных баз, данных показал, что существует несколько сотен различных последовательностей ретротранспозонов, относящихся к различным классам. Наиболее широко представлены в имеющихся базах данных мобильные элементы из группы родственных сopia-семейств. Также получены семейства неавтономных LTR ретротранспозонов (LARD и TRIM семейств), мобильных элементов генома, характерных для представителей семейств Fabaceae (таблица 2).

Гомологичные последовательности LTR ретротранспозонов из разных бобовых видов, использовали для дальнейшего конструирования универсальных ПЦР праймеров на консервативных участках LTR, в обоих направлениях.

 

Таблица 2.Основные ретротранспозоны для бобовых, использованные в работе
Table 2. The basic retrotransposons for legumes used in the work

Ретротранспозон

Retrotransposon

Генбанк ID, координаты, семейство

GenBank ID, coordinates, family

Группа видов

Species group

 

Cyclop 2

AC123573_:39225-49057_MEDICAGO

FJ402908_:4162-7038_GLYCINE

AP010285_:34994-37679_LOTUS

AJ000640_:4254-5767_PISUM

GU480450_:74405-75735_ARACHIS

AM486910_:3041-4315_VITIS

AC216840_:34384-35651_POPULUS

AC184065_:210-1477_POPULUS

AC243259_:33119-34366_PANICUM

AP011964_:3437-4669_JATROPHA

AC174437_:99267-100497_TERAMNUS

AC189538_:108708-109915_BRASSICA

DQ374052_:1251-2441_BETA

AB270792_:255332-256465_MALUS

GU235996_:146416-147346_COIX

GU906240_:40613-41484_SOLANUM

AB007467_:2484-3307_VICIA

AB046433_:67527-68310_ARABIDOPSIS

AC189538_:51734-52475_BRASSICA

Vicia, Arabidopsis, Brassica, Malus, Pyrus, Nicotiana, Medicago, Solanum Populus, Glycine, Teramnus, Vitis, Petunia, Lotus, Beta, Rosa, Capsicum, Liriodendron,

Coix, Jatropha, Arachis и другие

 
 

GMGYPSY10

AC185959:27940-26967: LTR

AC235175:78174-71655: Internal

Glycine max

 

GMOGRE_I

AC235199:19911-30100_Glycine

CU633440

Glycine max

Medicago truncatula

 

 

Дизайн праймеров является ключевым звеном ПЦР, поскольку именно они определяют возможность амплификации и выявления нужной последовательности, а также чувствительность и специфичность метода. Для разработки праймеров необходимо было принять во внимание, чтобы ретротранспозоны имели противоположную направленность и были достаточно близкими друг к другу для возможности амплификации межгенных областей. В этом случае будут генерироваться ампликоны, содержащие LTR области соседних ретротранспозонов и их консервативный PBS регион, а также промежуточный геномный сегмент переменной длины (рисунок 1).

А –IRAP (Inter-Retrotransposon Amplified Polymorphism), ПЦР между инвертированными праймерами (праймером) из LTRретротранспозона; Б –REMAP (REtrotransposon-Microsateliite Amplified Polymorphism), ПЦР между праймером из LTRретротранспозона и праймером из простого микросателлитного повтора; В –LTR-содержащие ретротранспозоны включают в себя короткий прямой повтор с каждого LTR. Между LTR кодируются гены, необходимые для жизненного цикла ретротранспозона: белок капсида (GAG), эндонуклеаза (EN), интеграза (IN), протеаза (AP), обратная транскриптаза (RT) и RNAseH (RH); участок связывания с тРНК(PBS), полипуриновый участок (РРТ)
Рис. 1.Общая структура ретротранспозонов. Принцип ПЦР амплификации, с помощью праймеров из последовательностей ретротранспозонов, расположенных вблизи друг друга, используемых для детекции полиморфизма ДНК
Fig. 1. The overall structure of retrotransposons. The principle of PCR amplification, using primers based on retrotransposons sequences, located in close proximity to each other, used for the detection of DNA polymorphism
 
А –IRAP (Inter-Retrotransposon Amplified Polymorphism), ПЦР между инвертированными праймерами (праймером) из LTRретротранспозона; Б –REMAP (REtrotransposon-Microsateliite Amplified Polymorphism), ПЦР между праймером из LTRретротранспозона и праймером из простого микросателлитного повтора; В –LTR-содержащие ретротранспозоны включают в себя короткий прямой повтор с каждого LTR. Между LTR кодируются гены, необходимые для жизненного цикла ретротранспозона: белок капсида (GAG), эндонуклеаза (EN), интеграза (IN), протеаза (AP), обратная транскриптаза (RT) и RNAseH (RH); участок связывания с тРНК(PBS), полипуриновый участок (РРТ)
Рис. 1.Общая структура ретротранспозонов. Принцип ПЦР амплификации, с помощью праймеров из последовательностей ретротранспозонов, расположенных вблизи друг друга, используемых для детекции полиморфизма ДНК
Fig. 1. The overall structure of retrotransposons. The principle of PCR amplification, using primers based on retrotransposons sequences, located in close proximity to each other, used for the detection of DNA polymorphism

 

Кроме того, существует вероятность того, что праймеры могут отжигаться друг с другом, образуя димеры, это приводит к значительному расходу праймеров на синтез побочных (неспецифических) продуктов реакции и, как следствие, значительно уменьшает чувствительность системы, что затрудняет или делает невозможным чтение результатов реакции при проведении электрофореза.

Последующий анализ последовательностей ретротранспозонов, проведенный с использованием программы FastPCR, позволил выделить последовательности ретротранспозонов для дальнейшей разработки праймеров к консервативным участкам, специфичным для геномов бобовых растений (таблица 3).

Для проведения PBS амплификации использовали праймеры, разработанные ранее Kalendar R. et al [15]. Длина PBS-участков ретротранспозонов, на которые были ориентированы в обоих направлениях праймеры, не превышает 18 нуклеотидов.

 

Таблица 3. Последовательности эффективных олигонуклеотидов, разработанных для детекции полиморфизма бобовых трав методом IRAP-ПЦР
Table 3. Sequences of effective oligonucleotides designed for the detection of legume polymorphism by the IRAP-PCR method

ID

Последовательность (5’-3’)

Sequence

Источник последовательности

Sequence source

Tm(°C)

ГЦ (%)

4347

CTGCTCCAAATCCCTTTCTTTTGCTCCAAGA

Medicago LTR

62.4

45.2

4352

ACCCGGAAGGGCGGTTCATGCAA

Medicago LTR

65.2

60.9

4353

GCAAGTAACTATATCTGGCCAACC

Medicago LTR

56.4

45.8

4354

CCCCTTGGGGCATCTGCAGC

Medicago LTR

65.3

70.0

4372

ACGGAGTTCTTTAGCAAGTTCCTC

Medicago LTR

57.0

45.8

4374

GTGCCTAACACCTTCCCGTA

Medicago LTR

57.1

55.0

4376

GCTACGGGAAGGTGTTAGGCACC

Medicago LTR

62.8

60.9

4377

CGTACCCTTTTAAGGGATCAAAACC

Medicago LTR

56.9

44.0

4378

ACTTAAATTACAACTTTCTAGCACTTATCA

Cyclop2 LTR

52.5

26.7

4379

TGATATTTGGTGTCGAACGGTC

Cyclop2 LTR

55.3

45.5

4380

ATCGCACTAGTCCCTGAGGA

Cyclop2 LTR

56.7

55.0

4383

CTTACAAATATGGATGGAGAGGAGTTACC

Ogre Internal

57.0

41.4

4384

TGTGCCCCGCGATGAGAATCAAATGG

Ogre Internal

63.6

53.8

4385

AGACCCGGCATGTCTTTGTATGACCA

Ogre Internal

61.3

50.0

 

Нуклеотидные последовательности этих PBS-участков универсальны для всех ретротранспозонов и относятся к высокоповторяющимся повторам, характерным для высших эукариот. Последовательности используемых праймеров, комплементарных участкам различных ретротранспозонов, представлены в таблице 4.

Критериями эффективности используемых праймеров являлись равномерность насыщения спектров амплификации, а также индекс детектируемого полиморфизма. Праймеры, генерировавшие мало ПЦР-продуктов, были отброшены, также были исключены праймеры, которые при хорошем насыщении спектров давали в основном мономорфные продукты.

 

Таблица 4. Последовательности используемых 18-мерных PBS праймеров
Table 4. Sequences used 18-mer primers PBS

ID

Последовательность

(5’-3’)

Sequence

Tm (°C)

ГЦ-состав (%)

GC-content

Эффективность праймера

(0 до 5)

Primer efficiency

(0 to 5)

2077

CTCACGATGCCA

43.5

58.3

5

2217

ACTTGGATGTCGATACCA

50.0

44.4

5

2220

ACCTGGCTCATGATGCCA

56.5

55.6

4

2222

ACTTGGATGCCGATACCA

53.2

50.0

5

2224

ATCCTGGCAATGGAACCA

54.1

50.0

5

2228

CATTGGCTCTTGATACCA

49.8

44.4

5

2230

TCTAGGCGTCTGATACCA

51.5

50.0

5

2232

AGAGAGGCTCGGATACCA

54.1

55.6

5

2237

CCCCTACCTGGCGTGCCA

63.1

72.2

5

2239

ACCTAGGCTCGGATGCCA

57.9

61.1

5

2240

AACCTGGCTCAGATGCCA

56.4

55.6

4

2244

GGAAGGCTCTGATTACCA

51.7

50.0

4

2248

ACCTAGGCTCTGATACCA

51.3

50.0

5

2251

GAACAGGCGATGATACCA

52.2

50.0

5

2253

TCGAGGCTCTAGATACCA

50.9

50.0

5

2255

GCGTGTGCTCTCATACCA

55.1

55.6

4

2256

GACCTAGCTCTAATACCA

47.4

44.4

5

2257

CTCTCAATGAAAGCACCA

50.3

44.4

5

2300

CACCGGGCTCTGATACCA

57.0

61.1

5

2373

GAACTTGCTCCGATGCCA

56.0

55.6

5

2395

TCCCCAGCGGAGTCGCCA

63.5

72.2

5

2396

GGGAACCTGCCGATACCA

57.5

61.1

5

 

2397

ATGGTCGCTCTGATACCA

52.5

50.0

4

2400

CCCCTCCTTCTAGCGCCA

59.7

66.7

5

2401

AGTTAAGCTTTGATACCA

45.4

33.3

4

 

Анализ генетического полиморфизма многолетних бобовых трав с использованием праймеров к LTR ретротранспозонам

Амплификация ДНК различных видов бобовых трав с праймерами к высокоповторяющимися последовательностями ретротранспозонов показала, что разработанные праймеры являются высокоэффективными для детекции полиморфизма ДНК. Количество полиморфных локусов более чем достаточно для дифференциации исследуемых генотипов, которые отличались уникальным сочетанием полиморфных амплифицированных фрагментов различного молекулярного веса. Размеры амплифицированных ПЦР фрагментов варьировали от 150 до 4000 п.о.

Размеры и количество амплифицированных фрагментов, характер их распределения в спектрах различных видов бобовых, является индивидуальным и неповторимым для каждого генотипа (рисунок 2, 3).

Анализ распределения ампликонов в спектрах ДНК различных видов показывает возможность использования праймеров к LTR ретротранспозонам для определения сортовой принадлежности или генетической оригинальности. Внутривидовой полиморфизм, выявляемый с использованием PBS праймеров, может достигать 40-60%, при исследовании генетически отдаленных видов – 80-100%. 

Рис. 2. ДНК-фингерпринт линий люцерны Medicago sativa с использованием LTR праймеров из ретротранспозонов генома бобовых (4347, 4374, 4354, 4376, 4377)
Fig. 2. DNA fingerprints lines of alfalfa (Medicago sativa) using LTR primers from legume retrotransposons (4347, 4374, 4354, 4376, 4377)
 
Рис. 2. ДНК-фингерпринт линий люцерны Medicago sativa с использованием LTR праймеров из ретротранспозонов генома бобовых (4347, 4374, 4354, 4376, 4377)
Fig. 2. DNA fingerprints lines of alfalfa (Medicago sativa) using LTR primers from legume retrotransposons (4347, 4374, 4354, 4376, 4377)

 

Рис. 3. ДНК-фингерпринт линий люпина Lupinus angustifolium с использованием универсального PBS праймера 2253
Fig. 3. DNA fingerprints lines of lupine Lupinus angustifolium using universal primer binding site (PBS) 2253
 
Рис. 3. ДНК-фингерпринт линий люпина Lupinus angustifolium с использованием универсального PBS праймера 2253
Fig. 3. DNA fingerprints lines of lupine Lupinus angustifolium using universal primer binding site (PBS) 2253

 

 

Были выявлены PBS праймеры, которые проявили определенную специфичность, характерную для конкретного вида бобовых трав. Это явление может быть использовано для дальнейшей генетической паспортизации сортов и образцов бобовых трав. Следует отметить, что все генотипы бобовых трав, представленные в коллекции, показывали высокую степень гетерогенности при использовании данных праймеров, наиболее высоким этот показатель был у образцов люцерны (до 20% внутри сорта), но это не снижало специфичность разработанных праймеров (таблица 5).

 

Таблица 5. Оценка информативности разработанных PBS праймеров в выявлении генетического полиморфизма кормовых бобовых трав
Table 5. Assessment of PBS primers designed for detection of genetic polymorphism of forage legumes

Культура

Crop

ID праймера

Primers ID

Полиморфизм, %

Polymorphism, %

Люцерна (Medicago sativa L.)

2217

86

2232

89

2237

100

Люпин (Lupinus angustifolius L.)

2253

56

Клевер (Trifolium sp.)

2397

100

2256

100

2396

94

2248

86

Донник (Melilotus sp.)

2222

100

2228

100

2230

100

2239

96

 

Преимущество использования IRAP и PBS методов амплификации заключается в возможности одновременной детекции большого числа полиморфных локусов ДНК, что позволяет использовать данные методы для молекулярно-генетической идентификации и паспортизации сортов, гибридов и линий бобовых растений.

В целом, исследование генетического биоразнообразия многолетних бобовых трав с использованием IRAP и iPBS маркеров выявило высокую степень дифференциации как внутри вида, так и между видами в одном таксоне. В частности, видоспецифичные ампликоны, полученные с использованием универсальных PBS праймеров могут быть использованы для дальнейшего детального анализа с целью разработки фенотипических маркеров. Данная система генетических маркеров может быть эффективно использоваться для исследования генетического разнообразия и других видов семейства Fabaceae.

 

ВЫВОДЫ

Результаты проведенных исследований показывают, что для выявления ДНК полиморфизма и исследования генетического разнообразия растений можно эффективно использовать новые типы маркеров, основанные на полиморфизме высокоповторяющихся последовательностей, ретротранспозонов. Высокая степень информативности используемых маркерных систем обусловлена повсеместным распространением последовательностей ретротранспозонов по всем хромосомам, включая кодирующие участки и гетерохроматин, за исключением теломерных и центромерных участков хромосом. ДНК фингерпринт на основе IRAP и PBS технологии амплификации является наиболее быстрым и экономически более выгодным способом идентификации и паспортизации селекционного материала, ввиду охвата значительного числа локусов на различных участках хромосом (гены, повторы, структурный хроматин и т.д.).  Использование ретротранспозонов вследствие их многокопийности и значительного количества амплифицированных локусов представляет несомненный интерес.

 

Финансирование

Исследования выполнены при поддержке Министерства образования и науки РК по проекту «Изучение исходного и селекционного материала кормовых трав с помощью ДНК фингерпринта, на основе новых типов молекулярно-генетических маркеров, выявляющих полиморфизм основных фракций генома, для повышения качества селекции», выполняемому в рамках НТП «Увеличение продуктивности многолетних и однолетних кормовых культур, путем создания новых стрессоустойчивых сортов, с улучшенным качеством корма, адаптированных к различным почвенно-климатическим условиям Казахстана» на 2015-2017 гг.

 

REFERENCES

 

  1. Dost M., Ates S. Intercropping of legumes with cereal crops in particular with the perennials to enhance forage yields and quality. Proc. of the FAO expert workshop «Perennial crops for food security», FAO, Rome, 2014, рр. 221-229.
  2. Zhakeev M.K. (2013) K 2020 godu posevnaja ploshhad' kormovyh kul'tur v Kazahstane uvelichitsja do 10,2 millionov gektar (By 2020, the sown area of fodder crops in Kazakhstan will increase to 10.2 million hectares).
    link
  3. Vasin V.G., Tolpekin A.A. idr. Jenergeticheskaja effektivnost' polevyh agrofitocenozov v Srednem Povolzh'e [Energy efficiency of field agrophytocenosis in the Middle Volga region]. Samara, 2005, 124 p.
  4. Serebrovskij A.S. Geneticheskij analiz [Genetic Analysis]. Moscow: Mir, 1970, 342 p.
  5. Carelli M., Gnocchi S., et al. Genetic diversity and dynamics of Sinorhizobium meliloti population’s nodulating different alfalfa cultivars in Italian soils. Applied and Environmental Microbiology, 2000, vol. 66, no. 11, pp. 4785-4789.
    CrossRef
  6. Khlestkina E.K. Molecular markers in genetic studies and in breeding.  Russian Journal of Genetics: Applied Research, 2014, vol. 4, no. 3, pp. 236-244.
    CrossRef
  7. Kalendar R., Schulman A.H. Transposon-based tagging IRAP, REMAP, and iPBS. Methods in Molecular Biology, 2014, vol. 1115, pp. 233-255.
    CrossRef
  8. Hora A., Malik C.P. Evaluation of genetic relationship between Trigonella‐Melilotus complex using CCMP markers. Plant Tissue Culture and Biotechnology, 2013, vol 23, no 1, pp. 59-66.
    CrossRef
  9. Schmutz J., McClean Ph.E., Mamidi S., Wu G.A. et al A reference genome for common bean and genome wide analysis of dual domestications. Nature Genetics, 2014, vol. 46, pp. 707-713.
    CrossRef
  10. Kalendar R., Antonius K., et al. iPBS: a universal method for DNA fingerprinting and retrotransposon isolation. Theoretical and Applied Genetics, 2010, vol.121, no. 8, pp.1419-1430.
    CrossRef
  11. Tagimanova D.S., Novakovskaya A.P., Uvashov A.O., Khapilina O.N., Kalendar R.N. Use of retrotransposon markers for analyzing the genetic diversity of wild emmer wheat (Triticum dicoccoides). Biotechnology. Theory and Practice, 2015, vol. 4, pp. 28-37.
    CrossRef
  12. Kalendar R.N., Aizharkyn K.S., Khapilina O.N., Amenov A.A., Tagimanova D.S. Plant diversity and transcriptional variability assessed by retrotransposon-based molecular markers. Vavilov Journal of Genetics and Breeding, 2017, vol. 21(1), pp.128-134.
    CrossRef
  13. Smykal P., Bačová-Kerteszová N. Genetic diversity of cultivated flax (Linum usitatissimum L.) germplasm assessed by retrotransposon-based markers. Theoretical and Applied Genetics, 2011, vol. 122, pp. 1385-1397.
    CrossRef
  14.  Guo D.L., Guo M.X., Hou X.G., Zhang G.H. Molecular diversity analysis of grape varieties based on iPBS markers. Biochemical Systematic and Ecology, 2014, vol. 52, pp. 27-32.
    CrossRef
  15. Baranek M., Meszaros M., Sochorova J., Cechova J., et al. Utility of retrotransposon-derived marker systems for differentiation of presumed clones of the apricot cultivar Velkopavlovicka. Scientia Horticulturae, 2012, vol. 143, pp.1-6.
    CrossRef
  16. Borna F., Luo S., Ahmad N.M., Nazeri V., Shokrpour M., Trethowan R. Genetic diversity in populations of the medicinal plant Leonurus cardiaca L. revealed by inter-primer binding site (iPBS) markers.Genet Resourses and Crop Evolution, 2016.
    CrossRef
  17. Andeden E.E. et al. iPBS-Retrotransposons-based genetic diversity and relationship among wild annual Cicer species. Journal of Plant Bio chemistry and Biotechnology, 2013, vol. 22 (4), pp. 453-466.
  18. Nemli S. et al. Genetic diversity and population structure of common bean (Phaseolus vulgaris L.) accessions through retrotransposon-based interprimer binding sites (iPBSs) markers. Turkish Journal of Agriculture and Forestry, 2015, vol 39, pp. 940-948.
    CrossRef
  19. Balish F.S. et al. DNA based iPBS-retrotransposon markers for investigating the population structure of pea (Pisum sativum) germplasm from Turkey. Biochemical Systematics and Ecology, 2015, no. 61, pp. 244-252. 
    CrossRef
  20. Kalendar R., Muterko A., Shamekova M., Zhambakin K. 2017. In silico PCR tools a fast primer, probe and advanced searching. Methods in Molecular Biology (Clifton, N.J.), vol. 1620, pp. 1-31.
    CrossRef

 

РЕТРОТРАНСПОЗОНДАР НЕГІЗІНДЕ КӨПЖЫЛДЫҚ БҰРШАҚ ТҰҚЫМДАС ШӨПТЕСІН ӨСІМДІКТЕРДІҢ ГЕНЕТИКАЛЫҚ ПОЛИМОРФИЗМІН ЗЕРТТЕУДЕ МОЛЕКУЛЯРЛЫҚ МАРКЕРЛЕРДІ ҚОЛДАНУ

 

Хапилина О.Н.1, Данияров А.Ж.1, Аменов А.А.1, Новаковская А.П.1, Туржанова А.С.1, Тагиманова Д.С.1, Филиппова Н.И.2, Календарь Р.Н.1
1Ұлттық биотехнология орталығы
Қорғалжын тас жолы, 13/5, Астана қ, Қазақстан
2А.И. Бараев атындағы астық шаруашылығы ғылыми-өндірістік орталығы, Ақмола облысы

This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Көпжылдық бұршақ тұқымдас шөптесін өсімдіктердің отандық және дүниежүзілік генетикалық қор арасында кездесетін сынамалардың түрішілік өзгергіштігін бағалау үшін ретротранспозондар реттіліктерінің негізінде молекулалық маркерлер қолданылды.

Жұмыс барысында Fabaceae тұқымдасының өсімдіктерінде спецификалық ретротранспозондар табылды. Fabaceae тұқымдасының өсімдіктерінде IRAP әдісі арқылы полиморфизді анықтауда, ПТР праймерлерін іріктеу барысында LTR аймағынан консервативті реттіліктер қолданылды. Сонымен қатар, PBS аймақтарындағы реттіліктерге колмплементарлы болып келетін, LTR ретротранспозондарына әмбебап праймерлер пайдаланылды. Амплификациялау нәтижелері бойынша, полиморфизмді 80% дейін анықтайтын ақпараттылығы жоғары праймерлер іріктеліп алынды. Полиморфизмді сандық бағалау мен дивергенция дәрежесін анықтауда кластерлік анализ жүргізілді. Жасалған LTR праймерлер геномда біркелкі орналасқан көптеген локустардың полиморфизмнің біруақытылы детекциясын жүргізуде жоғары эффективтілікті көрсетті. Сонымен қатар, генетикалық полиморфизмді зерттеуде ретротранспозондардың қолданысы жоғары ақпараттылық пен қол жетілімділікпен ерекшеленеді. LTR ретротранспозондары арқылы жүргізілген зерттеулер, көпжылдық бұршақ тұқымдас шөптесін өсімдіктер түрлерінің генетикалық алуантүрлілігі мен туыстық қатынастары бойынша топтастыруға мүмкіндік берді. Осы әдісті қолдану арқылы алынған зерттеу нәтижелері ұрық плазмасын бақылауда, болашақ систематикалық зерттеулер мен генетикалық тұрғыдан жақсартулар енгізуде негіз ретінде, сонымен қатар, өсімдік түрлерінің генетикалық өзгергіштігі мен геномдар динамикасындағы ретротранспозондардың рөлін зерттеуді қамтамасыз етеді.

Негізгі сөздер: көпжылдық бұршақ тұқымдас шөптесін өсімдіктер, молекулалық маркерлер, iPBS, ретротранспозондар, генотипирлеу.

Аббревиатура: LTR (Long Terminal Repeat); PBS (Primer Binding Site); IRAP (Inter Retrotransposone Amplified Polymorphism); REMAP (Retrotransposone Microsatellite Amplified Polymorphism); iPBS (Inter- Primer Binding Site Polymorphism).

Dog