2/2017
УДК 577.21; 604.4:577.15; 577.15
Akishev Zh.D.1,2, Abdullayeva A.N.1,2, AbeldenovS.K.1, KhassenovB.B.1

1National Center for Biotechnology,
13/5, Korgalzhyn road, Astana, 010000, Kazakhstan
2L.N.Gumilyov Eurasian National University,
2, Kanysh Satpayev str., Astana, 01000
8, Kazakhstan
This email address is being protected from spambots. You need JavaScript enabled to view it.
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ABSTRACT

Bovine chymosin (EC 3.4.23.4), which belongs to a family of aspartic proteases, is mainly derived from mammalian gastric mucosal cells of the abomasum of unweaned calves. Chymosin contains two residues of Asp in an active site, which catalyze the selective cleavage of a peptide bond in κ-casein between Phe105 and Met106. This catalytic process yields insoluble para-κ-casein, which causes milk coagulation. In this study, we sought to identify an alternative milk coagulant that is safe and efficient and, at the same time, can produce cheese with a good taste. Bovine prochymosin B was chosen and constitutively expressed at a high level in Pichia pastoris. The recombinant chymosin protein was expressed as a secretory form and was found to exhibit milk-clotting activity. It was stable at 25–50°C and had optimal activity at 37°C and pH 6.27. The activity of the recombinant chymosin was activated by cations such as Ca2+, Mg2+, Fe3+, Cd2+, Co2+, and Mn2+, but inhibited by Ni2+, and was not affected by Na+, K+, Cs2+, and Li+. These results suggest that recombinant bovine chymosin is an acid milk coagulant, and that it could be a safe and efficient enzyme suitable for use in cheese production.

Keywords: bovine, chymosin, casein, milk coagulation, Pichia pastoris.


INTRODUCTION

Rennet is a complex of enzymes consisting of two endopeptidases: pepsin and chymosin, which is used in the production of cheese products. It is mainly derived from mammalian gastric mucosal cells in abomassum which are taken from unweaned calves. Its key component, chymosin (EC 3.4.23.4), belongs to a family of aspartic proteases [1]. Their three-dimensional conformation, where the active site is located between both lobules, confers on them the ability to act against the Phe105-Met106 peptide bond present in milk k-casein molecules, originating insoluble para-κ-casein, which finally leads to milk coagulation [2]. Bovine chymosin is widely used for cheese production in the dairy industry. Traditional bovine chymosin production, however, requires the slaughter of a large numbers of calves; which keeps the price of chymosin high and also raises ethical issues [1]. Isolation and purification of active chymosin from bovine abomassum is time consuming and technically complex, involving affinity and ion exchange chromatography. Low purity (only 4-8% active chymosin) and contamination of the rennet with potential infectious agents also can be a concern. Therefore, the production of recombinant bovine chymosin is an attractive alternative method for obtaining the enzyme as the consumption of cheese increases globally. Currently, recombinant bovine chymosin, produced in yeast [3],Escherichia coli [4] and fungal cells [5], has been extensively used by cheese manufactures in many countries. The Pichia(Komagataella)pastoris expression platform has enabled a wide range of protein products to enter the market for therapeutic and industrial uses [6]. P. pastoris also produces only a relatively low level of native secreted proteins, which greatly assists the purification of recombinant protein.

The aim of this study was the production of a recombinant Pichia pastoris strain constructed in our laboratory, transformed with a bovine prochymosin sequence and secreting an inducible active chymosin activity to the fermentation medium.

 

MATERIALS AND METHODS

Strains, vectors, and reagents

For the cloning purposes Pfu and Taq DNA-polymerases, E. coli DH5α cells were obtained from laboratory stocks, all restriction enzymes, ligase, were purchased from Thermo Scientific (Fermentas, USA). Intermediate cloning TA vector pGEM-t was purchased from Promega (Wisconsin, USA). The yeast expression vectors pGAPZαA and pPICZαA and the yeast P. pastoris GS115 were obtained from Life Technologies, Inc. (Grand Island, NY, USA). Oligonucleotides synthesized at the National Center for Biotechnology (Astana, KZ) on the ASM-800 automatic synthesizer using the phosphoamidite method, followed by ammonolysis and purification in PAGE. Dry skim milk powder was purchased from Bio-Rad (USA). Commercial bovine chymosin («Dr.Guber», Russia) was used as a standard for determining of milk clotting activity, SDS-PAGE and Western blot controls. Anti-chymB antibodies were obtained by using immunized rabbit. All other chemicals used during work process were purchased from Sigma-Aldrich, AppliChem, Promega, and Amresco with quality of molecular biology grade.

 

Cloning of bovine prochymosin inintegral vectors and its expression in P.pastoris

Full length, bovine prochymosin DNA (1098 bp) (Genbank accession no. j00003.1) was synthesized de novo by PCR-based accurate synthesis of long DNA sequences [7]. Gene was cloned into the TA cloning vector, pGEM-T, and sequenced by Sanger method using «BigDye Terminanor v 3.1 Cycle sequencing Kit» with pUC/M13 forward and reverse primers to observe the correct assembling and any mutations in gene sequence. Mutations were eliminated by Quick Change protocol [8].Prochymosin gene prochymB was cloned into the P.pastoris expression vectors рPICZαA and рGAPZαA by EcoRI and NotI restriction sites. P.pastoris GS115 cells were transformed according to the manufacturer’s protocol (Life Technologies, Grand Island, NY, USA). Tansformants were selected on zeocin (200 µg/mL) YPD-agar (1% yeast extract, 2% peptone, 2% glucose) with additional screening of 15 colonies from each plate were analyzed for insertion by PCR and using milk-clotting activity enzyme assay. Clones with the highest clotting activity was selected and cells were inoculated in 10 ml of YPD medium with 200 µg/mL of zeocin and cultured for 24h, on the next day cells were collected by centrifugation at 2000×g for 15 minutes at +4°С and growth media was changed to BMGY or BMMY and were grown for 5 days. Every 24h cell-free supernatant was collected and stored on ice. Then cell-free supernatants were used for analysis in the enzymatic assay and SDS-PAGE [9,10] and Western Blot.

 

SDS-PAGE and Western Blotting

Polyacrylamide gel electrophoresis was accomplished according to the method of Laemmli [11] in a Mini-PROTEAN tetra cell (Bio-Rad). The anti-chymB polyclonal antibody was raised against the full-length recombinant His-tagged Bostauruspreprochymosin B protein. About 1 mg of the purified recombinant preprochymosin B was mixed with Freund’s complete adjuvant and injected into rabbit. Three additional injections were made at 2-week intervals. One week after the last injection, the blood was collected and the immune serum was purified by precipitation with 33% ammonium sulphate. The purified rabbit anti-ARP polyclonal antibody was used as a primary antibody, and horseradish peroxidase-conjugated goat anti-rabbit IgG, as a secondary antibody. Cultural media proteins were separated in a 10% SDS-polyacrylamide gel and then electroblotted onto a polyvinyl difluoride membrane (Pierce) using a BioRad Mini-transblot Cell according to the manufacturer’s instructions. After the protein transfer, the membrane was gently shook in blocking solution containing 5% milk and 0.1% Tween-20 in 1×TBS (Tris-buffered saline: 50 mMTris–HCl (pH 7.5), 20 mMNaCl) for 1 h at room temperature. After removing the blocking solution, the membrane was incubated in 10 mL of the affinity-purified anti-chymB polyclonal antibody (1:10,000 dilutionin the blocking solution with 0.1% Tween-20) overnight at 4°C. The membrane was washed five times in 10 mL of wash buffer (1×TBS with 0.1% Tween-20), for 5 min each time. After washing, the membrane was incubated in 10 mL of the secondary antibody (1:20,000 dilution in the blocking solution) for 1 h at room temperature. Then the membrane was washed five times in 10 mL of wash buffer, for 5 min each time. The working substrate solution was prepared by mixing an equal volume of peroxide solution and luminal/enhancer solution and used at 0.1 mL•cm2 of the blot area. The membrane was incubated in the working solution for 2 min in darkness and exposed to Agfa CP-BU x-ray film [12].

 

Enzymatic assay

Enzymatic activity of chymosin was assessed using the acidified to pH 4.0 growth media, which supposed to autocatalytic hydrolysis of “pro” 42 amino acids from N-terminal region of prochymosin. Substrate was prepared by mixing skim milk powder (12% w/v) in potassium phosphate buffer (pH 6.4). For screening purposes, 200 µL of 12% milk solution in potassium phosphate buffer supplemented with 40 mM CaCl2 was mixed with 50 µL of supernatant, and incubated at room temperature. Clotting time (s) was determined when the first flocculation was observed in the substrate film on the wall of the test tube[3].Finally, 4 mL of supernatant containing active chymosin was employed to elaborate milk curds using 1 L of pasteurized low-fat cow’s milk.

One unit (SU) of enzymatic activity was defined as the amount of enzyme needed to clot 1 ml of skim milk in 40 min at 37°C. This method was also used to determine the enzymatic activity in supernatants at different pH values, the optimal substrate pH, temperature, and Ca2+ concentration.

 

Determination of optimal substrate pH, temperature for enzymatic reaction and enzyme thermal stability, effect of calcium and other metals on enzyme activity

To determine the optimal substrate pH, skim milk powder was resuspended in Milli-Q water with 40 mMСаCl2, pH values was regulated with 1M citric acid or 0.1M NaOH in range of pH from 6.18 to 6.75 (6.18; 6.23; 6.27; 6.33; 6.38; 6.43; 6.48; 6.54; 6.60; 6.71; 6.75).

To determine optimal temperature for enzymatic reaction, 1 ml of substrate (12%-milk solution in 25 mM potassium-phosphate buffer with pH 6.27, and 40 mMСаCl2) was preheated at temperature from 25°С to 60°С for 10 minutes, and then enzyme in amount of 20 µl was added, mixed well avoiding foam formation and kept at appropriate temperature. Thermal stability was determined by incubation the cultural media with expressed enzyme within a temperature range 25°-65°С for 1h. At the same time enzyme solution was incubated at 4°С, 25°С and 37°С for 24h and then incubated within a temperature range 25°-65°С for 1h with recording a milk clotting time (s).

To study the effect of calcium and different metals on enzyme activity skim milk solution (12% w/v milk powder resuspendedin 25 mM potassium phosphate buffer, pH 6.27) was supplemented with 0-90 mM CaCl2, preheated for 3 minutes at 37°С. The enzyme solution was applied in amount of 20 µl, reaction was mixed well and a milk clotting time (s) was recorded. To determine effect of other metals 10 mM (KCl, NaCl, MgCl2, CsCl, FeCl3, CdCl2, LiCl, CoCl2, MnCl2, NiCl2) metals was added instead of calcium.

 

RESULTS AND DISCUSSION

The full-length bovineprochymosin gene was successfully synthesized, all mutations was eliminated by quick change PCR. The list of used oligonucleotides is presented in supplementary materials A. Gene was cloned into the yeast expression vectors, pPICZaA and pGAPZaA, under the control of the AOX1 and GAP promoters, to derive the expression vectors pPICZaA/ProchymB and pGAPZaA/ProchymB. Vectors were transformed in Pichia pastoris GS115, and clones were selected. In vivo, chymosin is synthesized as preprochymosin, which has a 16-amino acid lead peptide that is subsequently removed to produce the prochymosin. Under the acidic condition of the stomach, prochymosin is then converted to the mature enzyme, chymosin, by removal of the N-terminal 42-amino acid propeptide[13]. In order to obtain active bovine chymosin, we constructed recombinant plasmids contained only the sequence coding for the pro enzyme. The recombinant expression vectors pPICZaA/ProchymB and pGAPZaA/ProchymB were linearized with the restriction enzymes PagI and BspHI, respectively, and transformed into P. pastoris strain GS115 to express the target protein. After centrifugation, the culture supernatant was analyzed for milk-clotting activity. The molecular mass of bovine prochymosin predicted from the DNA sequence was 41 kDa, whereas the molecular mass of the mature enzyme was 35.6 kDa.

The milkclotting activity of the bovine chymosin was determined to be 540 SU/ml. Clotting activity of chymosin was strongly affected by temperature, with optimum activity occurred at 37°C, although the enzyme was stable at temperature ranging from 25°C to50°C. At temperature above 60°C, bovine chymosin was completely inactivated after 60 min. The activity of bovine chymosin was highly-dependent on pH, with optimum activity at pH 6.27.

Bovine chymosin was thus similar to buffalo and goat chymosins by having optimum activity at acidic pH, a property that would make the enzyme suitable for use in the production of cheese.

The effect of various metal ions on the milk-clotting activity of bovine chymosin was also evaluated. The activity of the enzyme was three times suppressed by 10 mM Ni2+, but was not affected by Na+, K+, Cs2+, Li+. The interesting thing is that the enzyme activity was increased in the presence of, except Ca2+, ions of Mg2+, Fe3+, Cd2+, Co2+, and Mn2+. The process of milk coagulation carried out by chymosin is divided into two stages. In the first stage, k-casein is hydrolyzed into para casein. In the second stage, Ca2+can combines with para casein to form a firm clot. The maximum milk clotting activity of bovine chymosin could be obtained at a CaCl2 concentration of 40 mM.

The enzymatic characteristic showed that this recombinant chymosin was similar to native calf chymosin in terms of optimum conditions; 37°C, pH 6.27 and 40 mM CaCl2. The enzyme was stable at temperature ranging from 25 to 50°C. The recombinant bovine chymosin described in this study exhibited satisfactory level of activity in k-casein hydrolysis. This study may provide an alternative strategy valuable for the preparation of milk coagulant suitable for the cheese making processing.

 

Funding

This work was performed within the framework of grant financing «Obtaining genetically engineered enzyme preparations of chymosin and β-galactosidase for deep milk processing» financed by the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. 5134/GF4).

 

Supplementary materials A

Table 1. Oligonucleotides list for bovine preprochymosin B synthesis

Name

Sequence 5’-3’

СhymF1

atgagatgtttggtggttttgttggctgttttcgctttgtctcaaggtgctgaaattactaggattccattgtacaaggg

СhymR2

tgcttttgcaagaaatcttccaacaaaccatgttccttcaaagcctttctcaaagacttacccttgtacaatggaatcct

СhymF3

gaagatttcttgcaaaagcaacaatacggtatttcttctaagtactctggttttggtgaagttgcttctgttccattgac

СhymR4

cccaagtaaatcttaccaaagtattgagaatccaagtagttagtcaatggaacagaagcaac

СhymF5

tttggtaagatttacttgggtactccaccacaagaatttactgttttgtttgatactggttcttctgatttctgggttcc

СhymR6

gactttcttggatcaaatctttgatggttcttacaagcgttagacttacagtaaatagatggaacccagaaatcagaaga

СhymF7

agatttgatccaagaaagtcttctacttttcaaaacttgggtaagccattgtctattcattacggtactggttctatgca

СhymR8

acagtttgttgaatatcaacaatgttagaaacagtaacagtatcgtaacccaaaataccttgcatagaaccagtaccgta

СhymF9

gttgatattcaacaaactgttggtttgtctactcaagaaccaggtgatgttttcacttacgctgaatttgatggtatttt

СhymR10

atcatgttatcgaaaactggaatagagtattcagaagccaaagatgggtaagccatacccaaaataccatcaaattcagc

СhymF11

ccagttttcgataacatgatgaacagacatttggttgctcaagatttgttttctgtttacatggatagaaacggtcaaga

СhymR12

acccaatgcaaagaaccagtgtagtaagatgggttaatagcacccaaagtcaacatagattcttgaccgtttctatccat

СhymF13

actggttctttgcattgggttccagttactgttcaacaatactggcaatttactgttgattctgttactatttctggtgt

СhymR14

accaacttagaagtaccagtatccaaaatagcttgacaaccaccttcacaagcaacaacaacaccagaaatagtaacaga

СhymF15

actggtacttctaagttggttggtccatcttctgatattttgaacattcaacaagctattggtgctactcaaaaccaata

СhymR16

atttcaaaaacaacagttggcatgtaagacaagttatcacaatcaatatcaaattcaccgtattggttttgagtagcacc

СhymF17

ccaactgttgtttttgaaattaacggtaagatgtacccattgactccatctgcttacacttctcaagatcaaggtttttg

СhymR18

ataaaaacatcacccaaaatccacttttgagaatggttttcagattgaaaaccagaagtacaaaaaccttgatcttgaga

СhymF19

attttgggtgatgtttttattagagaatactactctgtttttgatagagctaacaacttggttggtttggctaaggctatttaa

Сhymfw1

atgagatgtttggtggttttgttggctgttttcgctttgt

Сhymrv1

atcatgttatcgaaaactggaatagagtattcagaagcca

Chymfw2

ccagttttcgataacatgatgaacagacatttggttgctc

Chymrv2

ttaaatagccttagccaaaccaaccaagttgttagctcta

ChymF1fw1

atgagatgtttggtggttttgt

ChymF1rv1

cccaagtaaatcttaccaaagt

ChymF1rv2

atcatgttatcgaaaactggaat

ChymF2fw2

tttggtaagatttacttgggtac

ChymF2rv1

acccaatgcaaagaaccagtgtag

 

REFERENCES

 

  1. Kumar A., Grover S., Sharma J., Batish V.K. Chymosin and other milk coagulants sources and biotechnological interventions. Critical Reviews in Biotechnology, 2010, vol. 30,no.4. pp. 243-258.
  2. McMahon D.J., Brown R.J., Ernstrom C.A. Enzymic coagulation of milk casein micelles.J. Dairy Sci., 1984, vol. 67, pp. 745-748.
  3. Noseda D.G., Recupero M.N., Blasco M., Ortiz G.E., Galvagno M.A. Cloning, expression and optimized production in a bioreactor of bovine chymosin B in Pichia (Komagataella) pastoris under AOX1 promoter. Protein Expression Purif., 2013, vol. 92, pp. 235-244.
  4. Justesen S.F., Lamberth K., Nielsen L.L., Schafer-Nielsen C., Buus S. Recombinant chymosin used for exact and complete removal of a prochymosin derived fusion tag releasing intact native target protein.Protein Sci., 2009, vol. 8, pp. 1023-1032.
  5. Cardoza R.E., Gutierrez S., Ortega N., Colina A., Casqueiro J., Martin J.F., Expression of a synthetic copy of the bovine chymosin gene in Aspergillus awamori from constitutive and pH-regulated promoters and secretion using two different pre-pro sequences.Biotechnol.Bioeng., 2003, vol. 83, pp. 249-259.
  6. Cregg, J.M., T.S. Vedvick and WC. Raschke.. Recent advances in the expression of foreign genes in Pichia pastoris. BioTechnology, 1993,vol. 11, pp. 905-910.
  7. Xiong Ai-Sheng, Yao Quan-Hong, Peng Ri-He, Duan Hui, Li Xian, Fan Hui-Qin, Cheng Zong-Ming, Li, Yi. PCR-based accurate synthesis of long DNA sequences. Nat. Protocols., 2006, vol. 1, issue 2, pp. 791-797.
    CrossRef
  8. Zheng L., Baumann U., and ReymondJ.L..An efficient one-step site-directed and site-saturation mutagenesis protocol.Nucl. Acids Res., 2004, vol. 32, no. 14, e115, PMID:15304544.
  9. Abeldenov S.,Khassenov. B. Cloning, expression and purification of recombinant analog of Taq DNA polymerase. Biotechnology. Theory and Practice, 2014,no. 1,pp. 12-16.
  10. Mussakhmetov A.N.A., Abeldenov S., Khassenov B. Purification of recombinant Pfu DNA polymerase by double step affinity chromatography. Biotechnology. Theory and Practice, 2014,no. 2,pp. 42-47.
  11. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London, U.K.),1970, vol. 227, pp. 680-685.
  12. 12. TurgimbayevaА., BaltabekovaM., YelyubayA., IbrayevaA., MussakhmetovA., Abeldenov S., Khassenov B. Preparation of rabbit polyclonal antibodies against gfp and mcherry proteins. Biotechnology. Theory and Practice, 2014, no. 3, pp. 66-71.
  13. Pedersen V.B., Christensen K.A., Foltmann B. Investigations on the activation of bovine prochymosin.Eur J Biochem., 1979, vol. 94, pp. 573-580.​

БҰЗАУ ПРОХИМОЗИНДЫ PICHIA (KOMAGATAELLA) PASTORIS ЖАСУШАЛАРЫНДА ЭКСПРЕССИЯСЫ ЖӘНЕ СИПАТТАМАСЫ

 

Акишев Ж.Д.1,2, Абдуллаева А.Н.1,2, Абельденов С.К.1, Хасенов Б.Б.1
1Ұлттық биотехнология орталығы,
Қорғалжын тас жолы, 13/5, Астана, 010000, Қазақстан
2Л.Н.Гумилев атындағы Еуразия ұлттық университеті,
Қаныш Сәтпаев көшесі, 2, 010008, Астана, Қазақстан

This email address is being protected from spambots. You need JavaScript enabled to view it.
This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Бұзау химозині (EC 3.4.23.4) аспарагинді проеазалар тобына жатады, химозин жаңа туған бұзаулар асқазанының ұлтабар бөлімінің шырышты жасушаларынан алынады. Химозиннің белсенді сайтындағы екі Asp κ-казеин молекуласындағы Phe105 және Met106 арасындағы таңдамалы пептидті байланысын ыдыратады, бұл өз кезегінде сүт коагуляциясына әкелетін, ерімейтін пара-κ-казеинді тудырады. Берілген жұмыста, тиімді және қауіпсіз сүт коагулянтының баламасын алу үшін және дәмі жақсы ірімшік жасай алатын, бұзау В прохимозині таңдалып, жоғары деңгейде Pichia pastoris жасушаларында конститутивті түрде өндірілді. Рекомбинантты химозин секреторлы күйде экспрессияланып, сүт-ұйытқыш қасиетін көрсетті. Химозин 25-50°C тұрақтылық көрсетіп, 37°C және pH 6.27 көрсеткіштерінде оңтайлы белсендікке ие болды. Рекомбинантты химозин белсендігі Ca2+, Mg2+, Fe3+, Cd2+, Co2+катиондарымен белсендірілді, бірақ Ni2+ керісінше баяулатты, Na+, K+, Cs2+, Li+еш әсер етпеді. Алынған нәтижелер рекомбинантты бұзау химозинінің қышқылды сүт коагулянты екенін көрсетіп, оны ірімшік өндірісі үшін тиімді және қауіпсіз фермент ретінде қарастыруға мүмкіндік берді.

Негізгі сөздер: Бұзау, химозин, казеин, сүт коагуляциясы, Pichia pastoris. 

Dog