1/2016

УДК 57.052.6:577.217:577.218

 

Клонирование, экспрессия кДНК-гена PKR-киназы человека (HsPKR) в клетках бактерий и выделение рекомбинантного белка HsPKR

 

Жигайлов А.В., Кислицин В.Ю., Искаков Б.К.
Институт молекулярной биологии и биохимии им. М.А. Айтхожина
ул. Досмухамедова, 86, Алматы, 050012, Казахстан
*
andrzhig@yandex.ru

 

АБСТРАКТ

В эукариотических клетках фосфорилирование α-субъединицы фактора инициации трансляции 2 (eIF2α) является одним из основных механизмов торможения синтеза белков при стрессах. Такое фосфорилирование ингибирует обмен GDP на GTP у eIF2(αP), катализируемый фактором eIF2B, что резко замедляет инициацию трансляции мРНК. У растений отсутствуют биохимическая активность и гены eIF2B-подобного фактора. Выяснение механизма регуляции трансляции мРНК посредством фосфорилирования peIF2α остается не решенной задачей молекулярной биологии растений. 

Поскольку у растений отсутствует pPKR-киназа, то гетерологичная mPKR-киназа млекопитающих, активируемая двуспиральной (дс)РНК, может служить инструментом для контролируемого фосфорилирования peIF2α в растительных системах in vitro и in vivo.

В настоящей работе кДНК-ген HsPKR, кодирующий дсРНК-активируемую PKR-киназу человека, клонирован в векторе pET23c. Этот ген экспрессирован в клетках Escherichia coli, а кодируемый рекомбинантный белок HsPKR выделен аффинной (IMAC-) хроматографией. Функциональная активность HsPKR подтверждена в растительной системе in vitro по способности фосфорилировать TaeIF2α пшеницы в присутствии [γ-33P]ATP и методом иммуноблоттинга с использованием антител к фосфорилированной форме eIF2α. HsPKR-киназа может использоваться в экспериментах in vitro для исследования молекулярных механизмов регуляции трансляции мРНК растений посредством фосфорилирования peIF2α, а кДНК-ген HsPKR ‑ для получения трансгенных растений, устойчивых к вирусам.

Ключевые слова: фактор eIF2, фосфорилирование, PKR-киназа, клонирование, рекомбинантный белок. 


 

ВВЕДЕНИЕ

В эукариотических клетках стрессы, как правило, сопровождаются ингибированием синтеза белка, которое бывает тем значительнее, чем сильнее стрессовое воздействие [1]. Это необходимо для того, чтобы экономить энергию и ресурсы, направляя их на синтез специальных белков, помогающих пережить стресс. Одним из главных молекулярных механизмов ингибирования трансляции большинства клеточных мРНК во время стрессов в клетках млекопитающих является фосфорилирование α-субъединицы фактора meIF2 по Ser51 (соответствует Ser56 у peIF2α из Arabidopsis thaliana) протеин-киназами (PKR, HCR, PERK, GCN2), что приводит к быстрому и глубокому подавлению синтеза белка [2].

Фактор eIF2 необходим для инициации трансляции практически всех клеточных мРНК, он состоит из трех неидентичных субъединиц (α*β*γ) и формирует тройной комплекс (GTP*eIF2*Met-tRNAiMet), который затем связывается с 40S рибосомной субчастицей [3]. После каждого цикла инициации фактор meIF2 освобождается в виде прочного комплекса {meIF2*GDP}. Для функционирования фактора meIF2 в новом цикле связанная с ним молекула GDP должна быть заменена на GTP. Этот обмен не может протекать самостоятельно, так как сродство фактора meIF2 к GDP на 2 порядка выше, чем к GTP, и может осуществляться только при помощи вспомогательного фактора meIF2B.

У растений механизм торможения биосинтеза белка через фосфорилирование peIF2α значительно отличается. В нашей лаборатории впервые установлено, что для цикличного функционирования растительного peIF2 не требуется фактор eIF2B, который строго необходим у млекопитающих [4]. Наши результаты подтверждены другими группами исследователей [5-8]. В растительных клетках до сих пор не обнаружено генов, гомологичных генам субъединиц этого фактора eIF2B млекопитающих. Более того, из четырех киназ eIF2α, способных его фосфорилировать в клетках млекопитающих, в растительных клетках обнаружена лишь GCN2-киназа, которая фосфорилирует peIF2α при аминокислотном и пуриновом дефиците, а также при некоторых, но далеко не всех видах стрессов [9-10].

Эти данные свидетельствуют, что механизм ингибирования биосинтеза белка у растений посредством фосфорилирования фактора peIF2 значительно отличается от такового у млекопитающих и нуждается в тщательном исследовании. Для детального изучения механизма регуляции биосинтеза белка в растительных системах in vitro необходима система, способная осуществлять фосфорилирование peIF2α. Такой системой может служить рекомбинантная PKR-киназа млекопитающих, активирующаяся в присутствии двуспиральной РНК (дсРНК). PKR – серин/треониновая киназа, экспрессия которой индуцируется интерферонами [11]. Эта киназа имеет два дсРНК-связывающих мотива, располагающихся в N-концевом домене [12] и каталитический домен, располагающийся в С-концевой половине молекулы [13]. При связывании дсРНК, PKR-киназа димеризуется и подвергается автофосфорилированию по нескольким сайтам [12] и фосфорилирует главный свой субстрат, а именно α-субъединицу фактора eIF2.

В настоящей работе приводится описание клонирования кДНК-гена HsPKR-киназы, оптимизированная процедура выделения кодируемой им HsPKR-киназы и подтверждение, что выделенный и очищенный препарат рекомбинантного белка обладает PKR-активностью в растительной системе in vitro.

 

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

В работе использованы реагенты фирм «Sigma», «Serva», «Merck», «Fermentas», «Roche», «Promega», «Bio-Rad», «BioLabs», а также радиоактивная [γ-33P]ATP фирмы «Perkin Elmer». Олигодезоксирибонуклеотиды (олигоДНК) «hPKR-Nde-FW» (5’GGCCCATATGGCTGGTGATCTTTCAGCAGG), «hPKR-Xho-Rev» (5’ATTGGATCCTTACTCGAGACATGTGTGTCGTTCATTTTTCT), «T7-FW» (5’CGTAATACGACTCACTATAG) и «PET-MSC-Rev» (5’AGCTCAGCGGTGGCAGCAGC) были синтезированы на заказ в фирме «Sigma». В работе использовали зародыши пшеницы (Triticum aestivum L.) сорта Казахстанская-10, компетентные клетки E. coli штаммов DH5 и BL-21(DE3).

Компьютерный анализ нуклеотидных последовательностей ДНК и подбор праймеров для клонирования проводили с использованием компьютерных программ Vector NTI 8.0 и RNA-structure 3.5. Денситометрический анализ был выполнен с использованием компьютерной программы ImageJ v.1.42q.

Амплификация кДНК HsPKR проводилась с использованием высокоточной полимеразы Pwo («Roche») по методике производителя на амплификаторе GeneAmp 9700 («Applied Biosystems»). В качестве праймеров использовались «hPKR-Nde-FW» и «hPKR-Xho-Rev», а в качестве исходной матрицы – плазмида pUNO-hPRKR («InvivoGen»), несущая кДНК-ген человеческой PKR-киназы. Температурный режим ПЦР:  стадия 1 – 5 мин. при 94ºС – 1 цикл; стадия 2 – 30 сек. при 94ºС, 30 сек. при 57ºС, 1 мин. 30 сек. при 72ºС – 30 циклов; стадия 3 – 5 мин. при 72ºС – 1 цикл. Продукты ПЦР анализировали в 1%-ном агарозном геле.

Клонирование кДНК HsPKR. Продукты амплификации элюировали из агарозного геля с использованием набора DNA Gel extraction Kit («Fermentas»), обрабатывали рестрицирующими эндонуклеазами NdeI и XhoI и лигировали в вектор pET23c по тем же сайтам рестрикции с использованием Т4 ДНК-лигазы («Fermentas») по методике производителя.

Секвенирование ДНК конструкции pET23c-HsPKR-6His с использованием праймеров «T7-FW», «PET-MSC-Rev» и «hPKR-Xho-Rev» проводили с использованием коммерческого набора Big Dye Terminator v.3.1 («Applied Biosystems») по методике производителя. Капиллярный электрофорез проводили на генетическом анализаторе 310 («Applied Biosystems»), а анализ полученных данных осуществляли с использованием программы Sequencing Analysis 5.2.

Экспрессия и очистка рекомбинантной HsPKR. Полученной плазмидой pET23c-HsPKR-6His были трансформированы клетки E. coli экспрессионного штамма BL21(DE3) методом теплового шока (42°С, 90 сек). Трансформированные клетки растились в 100 мл жидкой среды LB при 30ºС до оптической плотности OD600=0,5; к среде добавлялся IPTG до конечной концентрации 1 мМ, после чего клетки дополнительно культивировали при 30ºС в течение 4 часов. Выделение рекомбинантной HsPKR, содержащей 6His-tag на своем С-конце, проводили в нативных условиях методом аффинной хроматографии IMAC (immobilized metal ion affinity chromatography) с использованием набора PerfectPro Ni-NTA Agarose (“5-Prime») по методике производителя. Диализ препарата белка для удаления имидазола проводился с использованием диализных мешков (“Sigma”) против диализного буфера (20 мМ TrisAc pH7,6; 90 мМ КАс; 2 мМ Mg(ОAc)2) в течение ночи при температуре 4оС.

Электрофорез белков проводился в полиакриламидном геле (T=12,5%, C=0,5%) в присутствии 0,1% SDS по стандартной методике Лэмли на приборе Mighti-small («Hoefer»). Гели окрашивали 0,125% раствором Кумаси бриллиантового голубого R-250 («Serva»).

Иммуноблоттинг. Перенос белков из ПАА-геля на 0,22 мк нитроцеллюлозную мембрану («Maine Manufacturing») проводили на аппарате для полусухого блоттинга («C.B.S. Scientific») в буфере для переноса (102 мМ глицина, 25 мМ Трис, 20% (о/о) этанола) при силе тока 0,8 мА см2 в течение 1 часа. Забивка осуществлялась в блокирующем буфере (5% обезжиренное сухое молоко «Fluka», 20 мМ ТрисHCl с pH 7,6, 140 мМ NaCl, 0,05% Tween-20) в течение ночи при 4ºС. В качестве первых антител использовались антитела Penta-His mouse antibodies («5-Prime») в разведении 1:2000 в блокирующем буфере, а в качестве вторых антител – Rabbit Anti-mouse HRP-conjugate (“5-Prime”) в разведении 1:2000 в блокирующем буфере. Проявку мембраны после ее промывки осуществляли с использованием хемилюминесцентного субстрата для пероксидазы фирмы “Promega”.

При исследовании активности рекомбинантной киназы методом иммуноблоттинга забивку мембраны проводили в блокирующем буфере, содержащем 5% BSA, 20 мМ ТрисHCl с pH 7,6; 140 мМ NaCl, 0,05% Tween-20. В качестве первых антител использовали моноклональные антитела кролика к фосфо-форме HseIF2α(Р): Phospho-eIF2a(Ser51) Antibody («Cell Signaling»), а в качестве вторых антител – Donkey Anti-rabbit HRP-conjugate («ECL»).

Выделение безмитохондриального экстракта (S23) и полирибосомной фракции (Ps) из зародышей пшеницы. Покоящиеся зародыши пшеницы замораживали жидким азотом и растирали в ступке, затем гомогенизировали с 6-ю объемами буфера, содержащего 250 мМ сахарозы, 5% глицерина (о/о), 20 мМ Трис-Ac с рН 7,6, 90 мМ КAc, 3 мМ Mg(OAc)2, 5 мМ ДТТ. Гомогенат центрифугировали при 23000 g в течение 20 мин и собирали надосадочную жидкость (S23-фракция). Для получения полирибосом (Ps) фракцию S23 наслаивали на подслойку 1 М сахарозы, приготовленной на буфере для гомогенизации, и центрифугировали в роторе SW-55Тi при 105000 g в течение 45 мин.

Проверка активности рекомбинантной PKR-киназы. Реакционная смесь объемом 20 мкл содержала 10 мМ TrisHCl с pH 7,6; 1 мМ ДТТ, 50 мM KAc, 5 мM Mg(OAc)2, 10 мкM ATP, 5 мкCi [γ-33P]ATP (10 мCi/мл, 3 мКи/ммоль) и 20 нг (0,3 пмоль) очищенной рекомбинантной PKR-киназы. Где необходимо, дополнительно добавляли poly(IC) до конечной концентрации от 2,5 нг/мл до 10 мкг/мл («Sigma»). Экстракт S23 и фракцию полирибосом (Ps) добавляли с таким расчетом, чтобы общая концентрация белка составляла 2,5 мкг/мкл и 1 мкг/мкл соответственно. Смесь инкубировали 25 мин при 30°С, затем белки разделяли электрофоретически в ПАА-геле, гели сушили и проводили их радиоавтографию.

Концентрацию белка определяли по Бредфорду в трех повторах с вычислением среднего арифметического значения (Xср) и ошибки среднего арифметического (m).

Общие методы (определение концентрации ДНК, электрофорез ДНК в агарозном геле, приготовление и трансформацию клеток E. coli, выделение плазмидной ДНК и др.) проводили согласно стандартным процедурам [14].

 

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

Для клонирования кДНК человеческой PKR-киназы она была амплифицирована с содержащей ее плазмиды pUNO-hPRKR с использованием праймеров «hPKR-Nde-FW» и «hPKR-Xho-Rev» и переклонирована в плазмиду pET23c по сайтам рестрикции NdeI и XhoI. При этом к 3’-концу ОРС, кодирующей HsPKR-киназу, добавлялись шесть гистидиновых триплетов, поэтому у рекомбинантной HsPKR-киназы на С-конце помещалась последовательность «6His-tag», позволяющая достаточно легко выделять рекомбинантный белок и проводить его детектирование антителами. Карта полученной плазмиды pET23c-HsPKR-6His представлена на рис. 1. Чтобы удостовериться в том, что в ходе клонирования не произошло случайное мутирование кДНК HsPKR, ее последовательность была выверена секвенированием.

Рис. 1. Карта плазмиды pET23c-HsPKR-6His
Fig. 1. pET23c-HsPKR-6His plasmid map
 
Рис. 1. Карта плазмиды pET23c-HsPKR-6His
Fig. 1. pET23c-HsPKR-6His plasmid map

 

Плазмидой pET23c-HsPKR-6His были трансформированы клетки экспрессионного штамма E. coli Bl-21(DE3). После экспрессии рекомбинантного гена в клетках бактерий синтезированный белок выделяли на 6His-tag методом аффинной хроматографии IMAC. Данные электрофоретического и вестерн-блот анализа различных фракций в ходе выделения рекомбинантной HsPKR представлены на рис. 2. Элюаты, содержащие наибольшие количества рекомбинантного белка, объединяли и очищали диализом с тем, чтобы избавиться от содержащегося в них имидазола.

А – 12,5% ПАА-гель, окрашенный Кумассии G250; Б – иммуноблот мембраны с использованием в качестве первых антител Mouse Penta-His Antibodies (“5-Prime”). М – BenchMark Pre-Stained Protein Ladder (“Invitrogen”); 1 – лизат бактерий до связывания с Ni-NTA агарозой; 2 – препарат белков, не связавшихся с Ni-NTA агарозой; 3 – препарат белков, смытых с колонки промывочным буфером; 4-6 – препараты белков, элюированных с колонки с Ni-NTA агарозой буфером, содержащим 20 мМ имидазола (1-я, 2-я и 3-я фракции соответственно); HsPKR – полнодлинная рекомбинантная PKR-киназа человека (64 кДа)
Рис. 2. Электрофореграмма и вестерн-блот анализ фракций рекомбинантной HsPKR в ходе ее очистки методом IMAC-хроматографии
А – Polyacrylamide gel (12.5%),stained with Coomassie G250; B – immunoblot-analysis using Mouse Penta-His primary antibody (5 Prime). M – BenchMark Pre-Stained Protein Ladder (Invitrogen); 1 ‑ bacterial lysate before binding to Ni-NTA agarose; 2 ‑ proteins which did not bind to Ni-NTA agarose (column flow through); 3 ‑ proteins washed from the column with wash-buffer; 4–6 ‑ Proteins eluted from the Ni-NTA agarose with buffer containing 20 mM imidazole (1st–3rd fractions, respectively). HsPKR – full-length recombinant human PKR (64 kDa).
Fig. 2. Electrophoresis and western blot analysis of recombinant HsPKR fractions purified by IMAC-chromatography
 
А – 12,5% ПАА-гель, окрашенный Кумассии G250; Б – иммуноблот мембраны с использованием в качестве первых антител Mouse Penta-His Antibodies (“5-Prime”). М – BenchMark Pre-Stained Protein Ladder (“Invitrogen”); 1 – лизат бактерий до связывания с Ni-NTA агарозой; 2 – препарат белков, не связавшихся с Ni-NTA агарозой; 3 – препарат белков, смытых с колонки промывочным буфером; 4-6 – препараты белков, элюированных с колонки с Ni-NTA агарозой буфером, содержащим 20 мМ имидазола (1-я, 2-я и 3-я фракции соответственно); HsPKR – полнодлинная рекомбинантная PKR-киназа человека (64 кДа)
Рис. 2. Электрофореграмма и вестерн-блот анализ фракций рекомбинантной HsPKR в ходе ее очистки методом IMAC-хроматографии
А – Polyacrylamide gel (12.5%),stained with Coomassie G250; B – immunoblot-analysis using Mouse Penta-His primary antibody (5 Prime). M – BenchMark Pre-Stained Protein Ladder (Invitrogen); 1 ‑ bacterial lysate before binding to Ni-NTA agarose; 2 ‑ proteins which did not bind to Ni-NTA agarose (column flow through); 3 ‑ proteins washed from the column with wash-buffer; 4–6 ‑ Proteins eluted from the Ni-NTA agarose with buffer containing 20 mM imidazole (1st–3rd fractions, respectively). HsPKR – full-length recombinant human PKR (64 kDa).
Fig. 2. Electrophoresis and western blot analysis of recombinant HsPKR fractions purified by IMAC-chromatography

 

Концентрация препарата рекомбинантной HsPKR после диализа по Бредфорду составила 152,5±5,3 мкг/мл. Однако, судя по данным денситометрического анализа, результаты которого представлены на рис. 3, полнодлинная рекомбинантная HsPKR-киназа составляла лишь 12,6% от всех белков в препарате. Значительная доля продуктов распада PKR в полученном препарате белка обуславливается достаточно высокой лабильностью HsPKR в клетках бактерий. Это согласуется с данными других исследователей, получающих рекомбинантную HsPKR [15]. Выход полнодлинного рекомбинантного белка составил 0,385 г на 1 литр исходной питательной среды для культивирования бактериальных клеток.

По оси ординат указаны условные единицы денситометрической плотности; по оси абсцисс ‑ расстояние от начала геля, см
Рис. 3. Денситометрический анализ электрофореграммы препарата рекомбинантной HsPKR после электрофореза в 12,5% ПАА-геле
On the ordinate axis ‑ the conventional units of densitometric density; on the abscissa axis ‑ the distance from the gel, cm
Fig. 3. Densitometric analysis of electrophoretogram after electrophoresis of recombinant HsPKR preparation in 12,5% PAA gel
 
По оси ординат указаны условные единицы денситометрической плотности; по оси абсцисс ‑ расстояние от начала геля, см
Рис. 3. Денситометрический анализ электрофореграммы препарата рекомбинантной HsPKR после электрофореза в 12,5% ПАА-геле
On the ordinate axis ‑ the conventional units of densitometric density; on the abscissa axis ‑ the distance from the gel, cm
Fig. 3. Densitometric analysis of electrophoretogram after electrophoresis of recombinant HsPKR preparation in 12,5% PAA gel

 

Чтобы проверить, обладает ли выделенная рекомбинантная HsPKR киназной активностью, проверялась ее способность фосфорилировать природный фактор eIF2 пшеницы (TaeIF2) in vitro на безмитохондриальном экстракте (S23) и полирибосомной фракции (Ps) в присутствии радиоактивно меченой [γ-33P]ATP. В качестве активатора PKR использовался препарат дсРНК-poly(IC) («Sigma»). Результаты представлены на рис. 4.

Как видно из данных, представленных на рис. 4, выделенная рекомбинантная HsPKR в присутствии poly(IC) фосфорилирует саму себя (дорожка 1 на рис. 4), а также ряд белков в экстракте S23 (дорожки 3 и 4 на рис. 4) и в полирибосомной фракции Ps (дорожки 6 и 7). Одним из фосфорилируемых белков является альфа-субъединица TaeIF2 (39 кДа).

Однако, в экстракте S23 и полирибосомной фракции Ps присутствует много других белков-мишеней PKR, а также эндогенные киназы (о последнем свидетельствуют радиоактивные полосы на дорожках 2 и 5 на рис. 4). По этой причине для проверки активности рекобинантной HsPKR было решено использовать метод иммуноблоттинга с применением моноклональных антител к фосфорилированному eIF2α человека (HseIF2α(Р). Поскольку эти антитела были специфичны к консервативной последовательности, формирующей сайт фосфорилирования Ser51 HseIF2α [16], которая была идентична таковой последовательности, формирующей сайт фосфорилирования Ser56 TaeIF2α, данные антитела могли специфично распознавать и фосфоформу TaeIF2α(Р).

Слева представлена полоска 12,5% ПАА-геля с белковым маркером, окрашенная Кумассии G250, а справа – радиоавтограф геля. М – белковый маркер PageRuler Plus Prestained Protein Ladder (“Thermo Scientific”); 1 – HsPKR+poly(IC); 2 – S23+poly(IC); 3 – S23+HsPKR; 4 – S23+HsPKR+poly(IC); 5 – Ps+poly(IC); 6 – Ps+HsPKR; 7 – Ps+HsPKR+poly(IC) 
Рис. 4. Проверка киназной активности препарата рекомбинантной HsPKR в бесклеточной системе из зародышей пшеницы в присутствии [γ-33P]ATP 
Polyacrylamide gel (12.5%). Left – gel with proteins stained with Coomassie G250. Right - autoradiograph of the gel. M – PageRuler Plus Prestained Protein Ladder (Thermo Scientific); 1 – HsPKR + poly(IC); 2 – S23 + poly(IC); 3 – S23 + HsPKR; 4 – S23 + HsPKR + poly(IC); 5 – Ps + poly(IC); 6 – Ps + HsPKR; 7 – Ps + HsPKR + poly(IC). 
Fig. 4. Testing kinase activity of recombinant HsPKR preparation in a wheat germ cell-free system in the presence of [γ-33P] ATP
 
Слева представлена полоска 12,5% ПАА-геля с белковым маркером, окрашенная Кумассии G250, а справа – радиоавтограф геля. М – белковый маркер PageRuler Plus Prestained Protein Ladder (“Thermo Scientific”); 1 – HsPKR+poly(IC); 2 – S23+poly(IC); 3 – S23+HsPKR; 4 – S23+HsPKR+poly(IC); 5 – Ps+poly(IC); 6 – Ps+HsPKR; 7 – Ps+HsPKR+poly(IC) 
Рис. 4. Проверка киназной активности препарата рекомбинантной HsPKR в бесклеточной системе из зародышей пшеницы в присутствии [γ-33P]ATP 
Polyacrylamide gel (12.5%). Left – gel with proteins stained with Coomassie G250. Right - autoradiograph of the gel. M – PageRuler Plus Prestained Protein Ladder (Thermo Scientific); 1 – HsPKR + poly(IC); 2 – S23 + poly(IC); 3 – S23 + HsPKR; 4 – S23 + HsPKR + poly(IC); 5 – Ps + poly(IC); 6 – Ps + HsPKR; 7 – Ps + HsPKR + poly(IC). 
Fig. 4. Testing kinase activity of recombinant HsPKR preparation in a wheat germ cell-free system in the presence of [γ-33P] ATP

 

Результаты вестерн-блот анализа представлены на рис. 5. Как видно из данных, представленных на этом рисунке, максимальная активность рекомбинантной HsPKR-киназы достигалась при концентрации дсРНК poly(IC), равной 100 нг/мл (дорожка 4 на рис. 5), что соответствует 1,23 пмоль/мл. Максимальная активность PKR в реакционной смеси достигается при двукратном избытке киназы по отношению к дсРНК (киназа активна лишь в том случае, когда две молекулы белка связываются с одной молекулой дсРНК). Если это соотношение киназы и дсРНК выше, то не все молекулы киназы в смеси активируются, а если оно ниже – на одну молекулу дсРНК будет приходиться менее двух молекул PKR-киназы. В то же время, в каждой реакционной смеси концентрация полнодлинной HsPKR-киназы составляла 12 пмоль/мл, что на порядок выше, чем расчетное содержание в реакционной смеси активной киназы (1,23 пмоль/мл). Одной из возможных причин такого несоответствия может быть наличие в экстракте S23 эндогенных дсРНК. Об этом свидетельствует активность HsPKR даже в отсутствии poly(IC) (если сравнить дорожку 1 с дорожкой 9 на рис. 5). Также возможно, что не все полнодлинные молекулы HsPKR в выделенном и очищенном препарате обладали активностью.

Слева представлена полоска нитроцеллюлозной мембраны с белковым маркером после переноса, а справа – иммуноблот мембраны (в качестве первых использовали антитела Phospho-eIF2a(Ser51) Antibody («Cell Signaling»), а в качестве вторых антител – конъюгат Donkey Anti-rabbit HRP-conjugate («ECL»). М – белковый маркер PageRuler Prestained Protein Ladder («Thermo Scientific»); 1 – S23+HsPKR; 2 – S23+HsPKR+5 нг/мл poly(IC); 3 – S23+HsPKR+50 нг/мл poly(IC); 4 – S23+HsPKR+100 нг/мл poly(IC); 5 – S23+HsPKR+200 нг/мл poly(IC); 6 – S23+HsPKR+500 нг/мл poly(IC); 7 – S23+HsPKR+1 мкг/мл poly(IC); 8 – S23+HsPKR+10 мкг/мл poly(IC); 9 – S23+100 нг/мл poly(IC)
Рис. 5. Исследование активности препарата рекомбинантной HsPKR-киназы методом иммуноблоттинга
Evaluation of the kinase activity of recombinant HsPKR in a wheat germ cell-free system in the presence of [γ-33P] ATP. Left - Strip of nitrocellulose membrane showing the protein marker transferred by western blotting after electrophoresis. Right - immunoblotted membrane. Primary antibody, Phospho-eIF2α (Ser51) (Cell Signaling); secondary antibody Donkey Anti-rabbit HRP-conjugate; Detection, ECL. M – Pa geRuler Prestained Protein Ladder (Thermo Scientific); 1 – S23 + HsPKR; 2 – S23 + HsPKR + 5 ng/ml poly(IC); 3 – S23 + HsPKR + 50 ng/ml poly(IC); 4 – S23 + HsPKR + 100 ng/ml poly(IC); 5 – S23 + HsPKR + 200 ng/ml poly(IC); 6 – S23+HsPKR + 500 ng/ml poly(IC); 7 – S23 + HsPKR + 1 μg/ml poly(IC); 8 – S23 + HsPKR + 10 μg/ml poly(IC); 9 – S23 + 100 μg/ml poly(IC).
Fig. 5. Investigation of recombinant HsPKR-kinase activity by immunoblotting.
 
Слева представлена полоска нитроцеллюлозной мембраны с белковым маркером после переноса, а справа – иммуноблот мембраны (в качестве первых использовали антитела Phospho-eIF2a(Ser51) Antibody («Cell Signaling»), а в качестве вторых антител – конъюгат Donkey Anti-rabbit HRP-conjugate («ECL»). М – белковый маркер PageRuler Prestained Protein Ladder («Thermo Scientific»); 1 – S23+HsPKR; 2 – S23+HsPKR+5 нг/мл poly(IC); 3 – S23+HsPKR+50 нг/мл poly(IC); 4 – S23+HsPKR+100 нг/мл poly(IC); 5 – S23+HsPKR+200 нг/мл poly(IC); 6 – S23+HsPKR+500 нг/мл poly(IC); 7 – S23+HsPKR+1 мкг/мл poly(IC); 8 – S23+HsPKR+10 мкг/мл poly(IC); 9 – S23+100 нг/мл poly(IC)
Рис. 5. Исследование активности препарата рекомбинантной HsPKR-киназы методом иммуноблоттинга
Evaluation of the kinase activity of recombinant HsPKR in a wheat germ cell-free system in the presence of [γ-33P] ATP. Left - Strip of nitrocellulose membrane showing the protein marker transferred by western blotting after electrophoresis. Right - immunoblotted membrane. Primary antibody, Phospho-eIF2α (Ser51) (Cell Signaling); secondary antibody Donkey Anti-rabbit HRP-conjugate; Detection, ECL. M – Pa geRuler Prestained Protein Ladder (Thermo Scientific); 1 – S23 + HsPKR; 2 – S23 + HsPKR + 5 ng/ml poly(IC); 3 – S23 + HsPKR + 50 ng/ml poly(IC); 4 – S23 + HsPKR + 100 ng/ml poly(IC); 5 – S23 + HsPKR + 200 ng/ml poly(IC); 6 – S23+HsPKR + 500 ng/ml poly(IC); 7 – S23 + HsPKR + 1 μg/ml poly(IC); 8 – S23 + HsPKR + 10 μg/ml poly(IC); 9 – S23 + 100 μg/ml poly(IC).
Fig. 5. Investigation of recombinant HsPKR-kinase activity by immunoblotting.

 

Таким образом, в ходе проведенной работы был клонирован и экспрессирован в клетках E. coli кДНК-ген HsPKR, выделен препарат рекомбинантной HsPKR-киназы, обладающий PKR-активностью в растительных системах in vitro.

Саму рекомбинантную киназу можно использовать для исследования молекулярных механизмов регуляции трансляции мРНК у растений посредством фосфорилирования альфа-субъединицы фактора peIF2 в системах in vitro. А кДНК-ген HsPKR планируется внедрить в геном картофеля. Поскольку в геноме растений отсутствуют гены, гомологичные гену PKR млекопитающих, они используют другие стратегии борьбы с вирусами. Экспрессия кДНК-гена HsPKR в клетках растений может привести к тому, что подобные генетически модифицированные растения картофеля будут обладать множественной устойчивостью к растительным вирусам. Подобные работы были успешно проведены в отношении растений табака [17].

 

ВЫВОДЫ

В экспрессионном векторе pET23c был клонирован кДНК-ген HsPKR, кодирующий дсРНК-зависимую PKR-киназу человека (HsPKR) с добавлением 6-ти гистидиновых кодонов на 3'-фланге открытой рамки считывания. Данная кДНК была экспрессирована в клетках E. coli экспрессионного штамма BL-21(DE3). Кодируемый рекомбинантный белок HsPKR был выделен аффинной хроматографией IMAC и очищен диализом. Активность рекомбинантной киназы была подтверждена в растительной системе in vitro с использованием радиоактивно меченной [γ-33P]ATP, а также методом иммуноблоттинга с использованием антител к фосфорилированной форме eIF2α. Рекомбинантная HsPKR-киназа будет в дальнейшем использована в экспериментах in vitro для исследования молекулярных механизмов регуляции трансляции у растений посредством фосфорилирования peIF2α, а кДНК-ген HsPKR ‑ для получения трансгенных растений, устойчивых к вирусам.

 

Финансирование

Работа выполнена в рамках научных проектов: 1920/ГФ4 «Исследование регуляции трансляции мРНК у растений посредством фосфорилирования альфа-субъединицы фактора инициации 2 (peIF2α)» и 4538/ГФ4 «Разработка биотехнологии создания генетически модифицированных растений картофеля с повышенной устойчивостью к абиотическим стрессам на основе оптимизации экспрессии мутированных вариантов трансгена AteIF2α».

 

REFERENCES

 

  1. Roy B., von Arnim A.G. Translational Regulation of Cytoplasmic mRNAs. The Arabidopsis Book, 2013, e0165.
    CrossRef PubMed
  2. Browning K.S. Plant translation initiation factors: it is not easy to be green. Biochemical Society Transactions, 2004, vol. 32, pp. 589-5913.
    CrossRef PubMed
  3. Hinnebusch A.G., Lorsch J.R. The mechanism of eukaryotic translation initiation: New insights and challenges. Cold Spring Harbor Perspectives in Biology, 2012, vol. 4, no. 10, a011544.
    CrossRef PubMed
  4. Shaikhin S.M., Smailov S.K., Lee A.V., Kozhanov E.V., Iskakov B.K. Interaction of wheat germ translation initiation factor 2 with GDP and GTP. Biochimie, 1992, vol. 74, pp. 447-454.
    CrossRef PubMed
  5. Janaki N., Krishna V.M., Ramaiah K.V.A. Phosphorylation of wheat germ initiation factor 2 (eIF-2) by N-ethylmaleimide-treated wheat germ lysates and by purified casein kinase II does not affect the guanine nucleotide exchange on eIF-2. Archives of Biochemistry and Biophysics, 1995, vol. 324, pp. 1-8.
    CrossRef PubMed
  6. Krishna V.M., Janaki N., Ramaiah K.V.A. Wheat germ initiation factor 2 (WG-eIF2) decreases the inhibition in protein synthesis and eIF2B activity of reticulocyte lysates mediated by eIF2a phosphorylation. Archives of Biochemistry and Biophysics, 1997, vol. 346, pp. 28-36.
    CrossRef PubMed
  7. Immanuel T.M., Greenwood D.R., MacDiarmid R.M. A critical review of translation initiation factor eIF2α kinases in plants – regulating protein synthesis during stress. Functional Plant Biology, 2012, vol. 39, pp. 717-735.
    CrossRef
  8. Browning K.S., Bailey-Serres J. Mechanism of cytoplasmic mRNA translation. The Arabidopsis Book, 2015, e0176, pp. 1-39.
    CrossRef PubMed
  9. Zhang Y., Wang Y., Kanyuka K., Parry M.A.J., Powers S.J., Halford N.G. GCN2-dependent phosphorylation of eukaryotic translation initiation factor-2α in Arabidopsis. Journal of Exp. Botany, 2008, vol. 59, pp. 3131-3141.
    CrossRef PubMed
  10. Lageix S., Lanet E., Pouch-Pelissier M.N., Espagnol M.C., Robaglia C., Deragon J.M., Pelissier T. Arabidopsis eIF2α kinase GCN2 is essential for growth in stress conditions and is activated by wounding. BMC Plant Biology, 2008, vol. 8, no. 134.
    CrossRef PubMed
  11. Krishnamoorthy T., Pavitt G.D., Zhang F., Dever T.E., Hinnebusch A.G. Tight Binding of the Phosphorylated a Subunit of Initiation Factor 2 (eIF2a) to the Regulatory Subunits of Guanine Nucleotide Exchange Factor eIF2B Is Required for Inhibition of Translation Initiation. Mol Cell Biol., 2001, vol. 21, no. 15, pp. 5018-5030. 87228.
    CrossRef
  12. Williams B.R. PKR: a sentinel kinase for cellular stress. Oncogene, 1999, vol. 18, no. 45, pp. 6112-6120.
    PubMed
  13. Meurs E., Chong K., Galabru J., Thomas N.S., Kerr I.M. et al. Molecular cloning and characterization of the human double-stranded RNA-activated protein kinase induced by interferon. Cell, 1990, vol. 62, pp. 379-390.
    CrossRef PubMed
  14. Sambrook J., Russel D.W. Molecular cloning: A laboratory manual: 3 volumes. Third edition. New York: Cold Spring Harbor Laboratory Press, 2001.
  15. Silva A.M., Whitmore M., Xu Z., Jiang Zh., Li X., Williams B.R.G. Protein Kinase R (PKR) Interacts with and Activates Mitogen-activated Protein Kinase Kinase 6 (MKK6) in Response to Double-stranded RNA Stimulation. JBC, 2004, vol. 279, no. 36, pp. 37670-37676.
    CrossRef PubMed
  16. Dey M., Trieselmann B., Locke E.G., Lu J., Cao C. et al. PKR and GCN2 kinases and guanine nucleotide exchange factor eukaryotic translation initiation factor 2B (eIF2B) recognize overlapping surfaces on eIF2alpha. Mol Cell Biol., 2005, vol. 25, no. 8, pp. 3063-3075.
    CrossRef PubMed
  17. Lim P.O., Lee U., Ryu J.S., Choi J.K., Hovanessian A. et al. Multiple virus resistance in transgenic plants conferred by the human dsRNA-dependent protein kinase. Molecular Breeding, 2002, vol. 10, pp. 11-18.
    CrossRef

 

АДАМ PKR-КИНАЗАСЫНЫҢ кДНК-ГЕНІН (HsPKR) БАКТЕРИЯ ЖАСУШАЛАРЫНДА  КЛОНДАУ, ЭКСПРЕССИЯЛАУ ЖӘНЕ HsPKR РЕКОМБИНАНТ БЕЛОГЫН БӨЛІП АЛУ

 

Жигайлов А.В., Кислицин В.Ю., Ысқақов Б.Қ.
М.Ә. Айтқожин атындағы молекулалық биология және биохимия институты
Досмухамедов к-сi, Алматы, 050012, Қазақстан
*This email address is being protected from spambots. You need JavaScript enabled to view it.

 

ТҮЙІН

Эукариоттық жасушаларда трансляцияны бастау факторының α-суббөлшегінің фосфорильденуі әртүрлі жағымсыз жағдай туғанда белок түзілуін тежеу тетіктерінің бірі болып табылады. Осы eIF2(αP) фосфорильдеуi, eIF2B факторымен катализденетін GDP-ның GTP-ға алмастыру тежеліп, мРНҚ трансляциясының басталуы өте бәсеңдейді.Өсімдіктерде eIF2B-факторға ұқсайтын гендер жоқ, сондықтан олардың биохимиялық әрекеттері де байқалмайды. peIF2α-ны фосфорильдеу арқылы мРНҚ трансляциясын реттеу өсімдіктер молекулалық биологиясының шешілмеген мәселесі болып отыр.

Өсімдіктерде pPKR-киназа болмағандықтан, сүт қоректілердің гетерологиялық mPKR-киназасы қос спиральды (қс) РНҚ-мен әрекеттенетін болғандықтан, өсімдіктер in vitro мен in vivo жүйелерінде бақыланатын peIF2α-ны фосфорильдеу құралы бола алады.

Бұл жұмыста адам қсРНҚ-мен әрекеттенетін PKR-киназасын кодтайтын HsPKR кДНК-гені pET23c векторының оқылатын клондалды. Бұл ген Escherichia coli жасушаларында экспрессияланды, ал HsPKR рекомбинант белогы аффинндық IMAC-хроматографиясы көмегімен бөлініп алынды. HsPKR іс әрекеті in vitro өсімдік жүйесінде бидай TaeIF2α-сына [γ-33P]ATP қосқанда HsPKR фосфорильденуі арқылы да, сондай-ақ иммуноблотинг әдісімен eIF2α-ның фосфорильденген түріне антиденелер пайдаланылғанда да расталды.

Әрекеті жарамды HsPKR-киназа in vitro тәжірибелерде өсімдіктердің peIF2α-сын фосфорильдеу арқылы мРНҚ трансляциясын реттеудің молекулалық тетіктерін зерттеу үшін, ал HsPKR кДНК-генін ‑ вирустарға төзімді трансген өсімдіктер шығаруға пайдалануға болады.

Негізгі сөздер: eIF2 факторы, фосфорильдеу, PKR-киназа, клондау, рекомбинант белок.